Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21233

Wdfy4 WD repeat and FYVE domain containing 4 ( MGI:3584510)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21233 EMAGE:21233 EMAGE:21233 EMAGE:21233 EMAGE:21233
"Pseudo-wholemount" of euxassay_014165. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014165_01 euxassay_014165_02 euxassay_014165_03 euxassay_014165_04
EMAGE:21233 EMAGE:21233 EMAGE:21233 EMAGE:21233 EMAGE:21233
euxassay_014165_05 euxassay_014165_06 euxassay_014165_07 euxassay_014165_08 euxassay_014165_09
EMAGE:21233 EMAGE:21233 EMAGE:21233 EMAGE:21233 EMAGE:21233
euxassay_014165_10 euxassay_014165_11 euxassay_014165_12 euxassay_014165_13 euxassay_014165_14
EMAGE:21233 EMAGE:21233 EMAGE:21233 EMAGE:21233 EMAGE:21233
euxassay_014165_15 euxassay_014165_16 euxassay_014165_17 euxassay_014165_18 euxassay_014165_19
EMAGE:21233 EMAGE:21233 EMAGE:21233
euxassay_014165_20 euxassay_014165_21 euxassay_014165_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21233Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21233_wholemount_strong.wlz
21233_wholemount_moderate.wlz
21233_wholemount_weak.wlz
21233_wholemount_possible.wlz
21233_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21233_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40125
Entity Detected:Wdfy4, WD repeat and FYVE domain containing 4 ( MGI:3584510)
Sequence:sense strand is shown

>T40125
TAGAGGCAGTGAACACTTTCCACCCCTACTTCTACGGTGATAGAATAGACCTGGGCAGCATCACTGACCC
GCTGATCAAGAGCACCATCCTGGGCTTCATCAGCAACTTTGGACAGGTGCCCAAGCAGATCTTCACTAAA
CCCCACCCATCCAGAAACACCACAGGGAAAAACCCAGGGCCTGGAAAGGATGCTTCCACCCCTGTAGGCC
TCCCAGGCCACTCACAGTCCTTCCTCCACAGCCTGCCAGCACTGAGACCCTCTCAGGTCACAGTCAAAGA
TATGTACCTTTTCTCTCTAGGGTCGGAATCCCCCAAAGGGGCCATCGGCCACATCGTCCCTACTGAGAAG
TCAATCCTGGCAGTGGAGAAGAACAAGCTGCTGATGCCCCCTCTCTGGAACAGGACCTTCAGCTGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 265772. Forward Primer - name:265772_F_cDNA_Wdfy4, sequence:TAGAGGCAGTGAACACTTTCCA; Reverse Primer - name:265772_N_SP6_cDNA_Wdfy4, sequence:CCCAGCTGAAGGTCCTGTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_014165 same experiment
 EMAGE:21229 same embryo
 EMAGE:21230 same embryo
 EMAGE:21231 same embryo
 EMAGE:21232 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS