Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21287

Ncor2 nuclear receptor co-repressor 2 ( MGI:1337080)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21287 EMAGE:21287 EMAGE:21287 EMAGE:21287 EMAGE:21287
"Pseudo-wholemount" of euxassay_009400. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009400_01 euxassay_009400_02 euxassay_009400_03 euxassay_009400_04
EMAGE:21287 EMAGE:21287 EMAGE:21287 EMAGE:21287 EMAGE:21287
euxassay_009400_05 euxassay_009400_06 euxassay_009400_07 euxassay_009400_08 euxassay_009400_09
EMAGE:21287 EMAGE:21287 EMAGE:21287 EMAGE:21287 EMAGE:21287
euxassay_009400_10 euxassay_009400_11 euxassay_009400_12 euxassay_009400_13 euxassay_009400_14
EMAGE:21287 EMAGE:21287 EMAGE:21287 EMAGE:21287 EMAGE:21287
euxassay_009400_15 euxassay_009400_16 euxassay_009400_17 euxassay_009400_18 euxassay_009400_19
EMAGE:21287 EMAGE:21287 EMAGE:21287 EMAGE:21287 EMAGE:21287
euxassay_009400_20 euxassay_009400_21 euxassay_009400_22 euxassay_009400_23 euxassay_009400_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21287Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21287_wholemount_strong.wlz
21287_wholemount_moderate.wlz
21287_wholemount_weak.wlz
21287_wholemount_possible.wlz
21287_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21287_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 2 weak expression: see section 1 3 4 5
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 2 weak expression: see section 1 3 4 5
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 weak expression: see section 2 3 4 5 1 2 3
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 0 1 weak expression: see section 8 9 2 3 4 5 6
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 9 0 1 2 3 4 5 6 7
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 4 5 6 7 8 9 0 1 2 weak expression: see section 9 8
spinal cord ventricular layer
weak weak
regionalweak expression: see section 2 3
lower jaw incisor
weak weak
regionalweak expression: see section 1 6
lower jaw molar
weak weak
regionalweak expression: see section 7 8 8
upper jaw incisor
weak weak
regionalweak expression: see section 1 6
upper jaw molar
weak weak
regionalweak expression: see section 7 8 9
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36669
Entity Detected:Ncor2, nuclear receptor co-repressor 2 ( MGI:1337080)
Sequence:sense strand is shown

>T36669
CTTTTAACCCTCTGAATGCCAGCGCCAGTCTGCCCGCTGCTGCTATGCCCATAACCACTGCTGACGGACG
GAGTGACCACGCACTCACCTCGCCAGGTGGAGGTGGGAAAGCCAAGGTCTCTGGCAGACCTAGCAGCCGA
AAAGCCAAGTCGCCAGCACCAGGCCTAGCGTCCGGAGACCGACCCCCTTCTGTCTCCTCAGTACACTCAG
AGGGGGACTGCAATCGCCGAACACCACTCACCAACCGTGTGTGGGAGGACCGGCCCTCATCTGCAGGGTC
CACGCCATTCCCCTACAACCCTTTGATTATGAGGCTACAGGCAGGTGTCATGGCCTCCCCGCCCCCACCT
GGCCTTGCGGCAGGCAGCGGGCCCCTAGCTGGTCCCCACCACGCCTGGGATGAGGAGCCCAAGCCACTGC
TGTGTTCACAGTATGAGACACTCTCGGACAGCGAGTGACCACGGATTGGGGGGGAGCGGTGCCAGGTCCC
GCACAAGGCAGAAGCAGCCCAGCATGGAGCAGACAGCTGCTGACTCCGGAGACTGAGGAAGGAGCCCCTG
AGTCTGCCTGCCGTCCATCCGTCCGTCCGTCCACTCATCTGTCCATCCAGAGCTGGCATCCTGCCTGTCT
AAAGCCTTAACTAAGACTCCCACCCCGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99474. Forward Primer - name:099474_F_cDNA_Ncor2, sequence:CTTTTAACCCTCTGAATGCCAG; Reverse Primer - name:099474_N_SP6_cDNA_Ncor2, sequence:CCGGGGTGGGAGTCTTAGTTA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009400 same experiment
 EMAGE:21285 same embryo
 EMAGE:21286 same embryo
 EMAGE:21288 same embryo
 EMAGE:21289 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS