Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21336

Art5 ADP-ribosyltransferase 5 ( MGI:107948)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21336 EMAGE:21336 EMAGE:21336 EMAGE:21336 EMAGE:21336
"Pseudo-wholemount" of euxassay_000014. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000014_01 euxassay_000014_02 euxassay_000014_03 euxassay_000014_04
EMAGE:21336 EMAGE:21336 EMAGE:21336 EMAGE:21336 EMAGE:21336
euxassay_000014_05 euxassay_000014_06 euxassay_000014_07 euxassay_000014_08 euxassay_000014_09
EMAGE:21336 EMAGE:21336 EMAGE:21336 EMAGE:21336 EMAGE:21336
euxassay_000014_10 euxassay_000014_11 euxassay_000014_12 euxassay_000014_13 euxassay_000014_14
EMAGE:21336 EMAGE:21336 EMAGE:21336 EMAGE:21336 EMAGE:21336
euxassay_000014_15 euxassay_000014_16 euxassay_000014_17 euxassay_000014_18 euxassay_000014_19
EMAGE:21336 EMAGE:21336 EMAGE:21336 EMAGE:21336
euxassay_000014_20 euxassay_000014_21 euxassay_000014_22 euxassay_000014_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21336Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21336_wholemount_strong.wlz
21336_wholemount_moderate.wlz
21336_wholemount_weak.wlz
21336_wholemount_possible.wlz
21336_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21336_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
strong strong
spottedstrong expression: see section 5 moderate expression: see section 1 2 3 4 7 8 0 4 8 9 1 2 3
forelimb
strong strong
spottedstrong expression: see section 4 moderate expression: see section 1 2 3
hindlimb
strong strong
spottedstrong expression: see section 4 8 moderate expression: see section 2 3 5 9 2 3
anterior abdominal wall musculature
strong strong
spottedstrong expression: see section 4 5 5
rectus abdominis
moderate moderate
spottedmoderate expression: see section 1 2
axial musculature
strong strong
spottedstrong expression: see section 1 3 4 5 5 moderate expression: see section 2 6 7 8 9 0 1 2 3 4 6 7 8 9 0 1 2 3
cranial musculature
strong strong
spottedstrong expression: see section 3 4 5 moderate expression: see section 6 7 8 9 0 1 2 3 4 6 7 8 9 0 1 2 3
masseter
strong strong
spottedstrong expression: see section 1 2
mylohyoid
strong strong
spottedstrong expression: see section 2
temporalis
strong strong
spottedstrong expression: see section 1 2
pectoral girdle and thoracic body wall musculature
strong strong
spottedstrong expression: see section 1
adrenal gland
strong strong
spottedstrong expression: see section 6
eye skeletal muscle
moderate moderate
spottedmoderate expression: see section 2 3
heart
strong strong
spottedstrong expression: see section 8 0 3 moderate expression: see section 7 9 1 2 4 6 7
tongue
strong strong
regionalstrong expression: see section 2 moderate expression: see section 1
tongue muscle
strong strong
regionalstrong expression: see section 3 4 5 6 moderate expression: see section 1
male reproductive system
moderate moderate
spottedmoderate expression: see section 7
testis
strong strong
spottedstrong expression: see section 4 5 6 7 moderate expression: see section 6 7 8
lung
strong strong
spottedstrong expression: see section 8 0 moderate expression: see section 1 6 7 8 9 0 weak expression: see section 9
viscerocranium
strong strong
spottedstrong expression: see section 2 6 moderate expression: see section 1 3
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1734
Entity Detected:Art5, ADP-ribosyltransferase 5 ( MGI:107948)
Sequence:sense strand is shown

>T1734
TGGCCTCGAGCCAGATTGGACGAGGCTGCGAGCGCCTGCCGGCACTTCAGCTCCAGTCAGCCGCAAAGAA
CCATAGCCCTGGGCCGGGCCGCTCTCTGTCTCAACTTCTTCCAGCTTCACCCCTCATCCCTCCTGAGTTC
CAGTCCTTGACTAAGGACCCTCCTAGGCTGAAGGAAGGAAGGTCCTGGAGCCCATCCAAGCCAGCACTCC
CCTCCACTGGCTTCATCATCATCAGGGTCCTGCTGTCTCGGGACTCGTCCTAGGATGATTCTGGAGGATC
TGCTGATGGTCCTCAGCTGCCTCAGCTTGCACGCCCTCTGGAAGGTTCGAGCTGTTCCTATCCTGCCCCT
GAGCCTGGTTCCAGATACCTTTGATGATGCCTATGTGGGCTGCTCTGAGGAGATGGAGGAGAAAGCAGGC
CTGCTGCTAAAGGAAGAGATGGCACGCCATGCCCTGCTGCGGGAATCCTGGGAAGCAGCACAAGAGGCCT
GGGCACACCGGCGTCACAAGCTCACTCTACCTCCTGGCTTCAAAGCCCAGCACGGAGTAGCGATTATGGT
G
Notes:The probe template was PCR amplified from IMAGE:480748 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:480748 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000014 same experiment
 EMAGE:21332 same embryo
 EMAGE:21335 same embryo
 EMAGE:21334 same embryo
 EMAGE:21333 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS