Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21352

Usp22 ubiquitin specific peptidase 22 ( MGI:2144157)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21352 EMAGE:21352 EMAGE:21352 EMAGE:21352 EMAGE:21352
"Pseudo-wholemount" of euxassay_000296. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000296_01 euxassay_000296_02 euxassay_000296_03 euxassay_000296_04
EMAGE:21352 EMAGE:21352 EMAGE:21352 EMAGE:21352 EMAGE:21352
euxassay_000296_05 euxassay_000296_06 euxassay_000296_07 euxassay_000296_08 euxassay_000296_09
EMAGE:21352 EMAGE:21352 EMAGE:21352 EMAGE:21352 EMAGE:21352
euxassay_000296_10 euxassay_000296_11 euxassay_000296_12 euxassay_000296_13 euxassay_000296_14
EMAGE:21352 EMAGE:21352 EMAGE:21352 EMAGE:21352 EMAGE:21352
euxassay_000296_15 euxassay_000296_16 euxassay_000296_17 euxassay_000296_18 euxassay_000296_19
EMAGE:21352 EMAGE:21352 EMAGE:21352 EMAGE:21352 EMAGE:21352
euxassay_000296_20 euxassay_000296_21 euxassay_000296_22 euxassay_000296_23 euxassay_000296_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21352Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21352_wholemount_strong.wlz
21352_wholemount_moderate.wlz
21352_wholemount_weak.wlz
21352_wholemount_possible.wlz
21352_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21352_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
moderate moderate
regionalmoderate expression: see section 2 3 4 5 6
telencephalon
moderate moderate
regionalmoderate expression: see section 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 weak expression: see section 1 2 3 4 1 2 3 4
medulla oblongata
moderate moderate
regionalmoderate expression: see section 9 0 1 2 3 4 5 6 7 8
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 5
metencephalon
moderate moderate
regionalmoderate expression: see section 9 0 1 2 3 4 6 7 8
metencephalon lateral wall
moderate moderate
regionalmoderate expression: see section 8 9 weak expression: see section 7
metencephalon alar plate
moderate moderate
regionalmoderate expression: see section 6 weak expression: see section 5
midbrain lateral wall
moderate moderate
regionalmoderate expression: see section 8 9 0 1 2 3 4 5 6 7 8 9
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 6 weak expression: see section 7 0 1
glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 6 weak expression: see section 5 0
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 6 9 0 1 8 9 weak expression: see section 4 5 7 8 0 1 2
vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 9 0 1 7 8 9 weak expression: see section 8
vestibulocochlear viii ganglion
moderate moderate
homogeneousmoderate expression: see section 9 weak expression: see section 7
spinal cord lateral wall
moderate moderate
regionalmoderate expression: see section 1 2 3 5 6 7
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 4
dorsal root ganglion
moderate moderate
homogeneousmoderate expression: see section 9 0 1 2 3 4 7 8
lens
moderate moderate
regionalmoderate expression: see section 2
neural retina
moderate moderate
regionalmoderate expression: see section 2 3 3 4 weak expression: see section 4
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3553
Entity Detected:Usp22, ubiquitin specific peptidase 22 ( MGI:2144157)
Sequence:sense strand is shown

>T3553
CCAATCCTCCCATGTTTCTTCTTGGTCTTTTTGCCTGCCCAGGGAGGTTTAGTGACTGTGTGAGATTTGA
AGCTGAGGTCCAGTTGGAGACTGCATTGCATAGTGTCACCCGCTTGCCTCCATTCTGTGTTCACTATAGT
TTCAGTTACAGCCAGAATAGGAAGGCTCCATTACCAGTTCTCCTGGCAGGGTCATTCATGAAGTTTATTG
TAAGATATTTTGCATGTATCTCTGGACAAGCCTAGGCTGTCCACTTCTGAGCAACTGGAATCTAGGGTCT
TGGTGTTTCTCCTCATACCACTGCCTTTCCAGTGGTGCTTACCCAGGAGCCTGTTGGCACCCACCCAGGA
GTTGCCCATCAGAACAGGCAACTATTTCCTAAGAGCCAGGCTCTGAGCCGTAGACCCATAGCAGGTAACA
CGTGCATCGTGTTTGCATAACAAGTACGGCTGTGATTTAAATTACATATAATTATGTGTACAGATACTTT
TTTTTTTTTTTTTTTTACTATTTGAAA
Notes:The probe template was PCR amplified from IMAGE:3166844 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3166844 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000296 same experiment
 EMAGE:21355 same embryo
 EMAGE:21353 same embryo
 EMAGE:21354 same embryo
 EMAGE:21351 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS