Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21362

Efnb2 ephrin B2 ( MGI:105097)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21362 EMAGE:21362 EMAGE:21362 EMAGE:21362 EMAGE:21362
euxassay_018950_01 euxassay_018950_02 euxassay_018950_03 euxassay_018950_04 euxassay_018950_05
EMAGE:21362 EMAGE:21362 EMAGE:21362 EMAGE:21362 EMAGE:21362
euxassay_018950_06 euxassay_018950_07 euxassay_018950_08 euxassay_018950_09 euxassay_018950_10
EMAGE:21362 EMAGE:21362 EMAGE:21362 EMAGE:21362 EMAGE:21362
euxassay_018950_11 euxassay_018950_12 euxassay_018950_13 euxassay_018950_14 euxassay_018950_15
EMAGE:21362 EMAGE:21362 EMAGE:21362 EMAGE:21362 EMAGE:21362
euxassay_018950_16 euxassay_018950_17 euxassay_018950_18 euxassay_018950_19 euxassay_018950_20
EMAGE:21362 EMAGE:21362 EMAGE:21362 EMAGE:21362
euxassay_018950_21 euxassay_018950_22 euxassay_018950_23 euxassay_018950_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21362Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21362_wholemount_strong.wlz
21362_wholemount_moderate.wlz
21362_wholemount_weak.wlz
21362_wholemount_possible.wlz
21362_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21362_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pericardium
moderate moderate
regionalmoderate expression: see section 9 0 1 2 7 8 9 weak expression: see section 3 6
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 2 3 4 5 6
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 4 5 6 7 8 9 3 4
submandibular gland primordium
weak weak
regionalweak expression: see section 8 9 0 1 8 9
vibrissa
weak weak
regionalweak expression: see section 6 7 8 9 4
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 3 4 6 7 8 9 0 1 2 3 4 5 6 7 8 0 1 2 3 4
telencephalon mantle layer
weak weak
regionalweak expression: see section 9
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 3 4 5 7 8 9 0
telencephalon ventricular layer
weak weak
regionalweak expression: see section 0 1 2 3 7 8 9 0
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 6
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 4 weak expression: see section 5
esophagus
weak weak
regionalweak expression: see section 4 5
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 3 4 weak expression: see section 8 9
lower jaw molar
weak weak
regionalweak expression: see section 9
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 4 weak expression: see section 5 8 9
upper jaw molar
weak weak
regionalweak expression: see section 9
bladder
weak weak
regionalweak expression: see section 5 6 7
metanephros
moderate moderate
regionalmoderate expression: see section 9 0 1 9 1 weak expression: see section 7 8 2 8 0 2
urethra of male
weak weak
regionalweak expression: see section 5 6
lung
moderate moderate
regionalmoderate expression: see section 3 4 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 weak expression: see section 5
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 4 6 7 8 9
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50379
Entity Detected:Efnb2, ephrin B2 ( MGI:105097)
Sequence:sense strand is shown

>T50379
TACTGCATCATTACGGGACACTCACCACAGAGTCCCAGCTCCACCCTTTACACCAAGATCAAATTAGATG
GGTATTAGGTACAGAAGAACCCTGCTTGCCTGGAGGCCGGGTCAGCCGGGAAGCGCAGATGTGTGGAGGA
GTGAGGAGGTGCTGGCTGCCACGGCAGGTCAAGGCTGCTTGCTGCCCCTGGAGCATAGTAGGGATGCAGG
AAGGAAATAGATAATGCTTTGGTTTTTCTGAGAGGACAGAGACAGGTGGGAGGTGACTGACTGGTGAGTG
GTGGGGAGCCTTTCACTACCACACAGCTATGCAGCAGGGAATCAAAAGTCCCTCTCCTGCGGGGAACAAA
GGGGCCATTGTTGTGAAAGGACCAGCTAGAGCACAGAGGGAGAGGGCAGGCCTCCGGTGAAGTGCTGGGG
CAGAACTGCAGAGGTACTGGAAATAAAAAGCGCAGCGCAGAGCTGTGGGAGAGTCCGTCTGCTTTGGGAG
ATGTTTTAAGCAGACTCAGCTGCTATATTACCACGTTTTTATTAAAAACACAGGGAAAGCATTTAGGAGA
AGAGCAGAGAGCCAAATCTGACCTAGAAGTTGAAAAGCCAAAGGTCAAACAGGCTGTAAGTCCATCACCA
CTGAGGTTATTGGAGAATTCTCATTAGGAAAGGCAGGTCAGATTCCCCAGGCCCCATAAGTGCCCCTTCC
CCCTCCCTGATTGAGCCTTACACGTTGGTT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TACTGCATCATTACGGGACACTC; Reverse Primer - name:unspecified, sequence:AACCAACGTGTAAGGCTCAATCAG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_018950 same experiment
 EMAGE:21363 same embryo
 EMAGE:21364 same embryo
 EMAGE:21365 same embryo
 EMAGE:21366 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS