Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21377

Il16 interleukin 16 ( MGI:1270855)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21377 EMAGE:21377 EMAGE:21377 EMAGE:21377 EMAGE:21377
euxassay_000919_01 euxassay_000919_02 euxassay_000919_03 euxassay_000919_04 euxassay_000919_05
EMAGE:21377 EMAGE:21377 EMAGE:21377 EMAGE:21377 EMAGE:21377
euxassay_000919_06 euxassay_000919_07 euxassay_000919_08 euxassay_000919_09 euxassay_000919_10
EMAGE:21377 EMAGE:21377 EMAGE:21377 EMAGE:21377 EMAGE:21377
euxassay_000919_11 euxassay_000919_12 euxassay_000919_13 euxassay_000919_14 euxassay_000919_15
EMAGE:21377 EMAGE:21377 EMAGE:21377 EMAGE:21377 EMAGE:21377
euxassay_000919_16 euxassay_000919_17 euxassay_000919_18 euxassay_000919_19 euxassay_000919_20
EMAGE:21377 EMAGE:21377 EMAGE:21377 EMAGE:21377
euxassay_000919_21 euxassay_000919_22 euxassay_000919_23 euxassay_000919_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21377Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21377_wholemount_strong.wlz
21377_wholemount_moderate.wlz
21377_wholemount_weak.wlz
21377_wholemount_possible.wlz
21377_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21377_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
limb
moderate moderate
homogeneousmoderate expression: see section 4 5 2 4 not examined expression: see section 1 2 3 0 1 2 3
forelimb digit 1 mesenchyme
strong strong
homogeneousstrong expression: see section 2 weak expression: see section 2
forelimb digit 2 mesenchyme
strong strong
homogeneousstrong expression: see section 1 2 weak expression: see section 2
forelimb digit 3 mesenchyme
strong strong
homogeneousstrong expression: see section 1 2 weak expression: see section 2
forelimb digit 4 mesenchyme
strong strong
homogeneousstrong expression: see section 1 2 weak expression: see section 2
forelimb digit 5 mesenchyme
weak weak
homogeneousweak expression: see section 2
thymus primordium
strong strong
homogeneousstrong expression: see section 1 2 3 4 5 6
vibrissa epidermal component
strong strong
homogeneousstrong expression: see section 2 3 4 5 9 0 1 2 3
dorsal root ganglion
moderate moderate
homogeneousmoderate expression: see section 3 4 weak expression: see section 1 2 5 6
lower jaw mesenchyme
moderate moderate
homogeneousmoderate expression: see section 0 1 2 3 weak expression: see section 8 9 4 5 6 7 8
respiratory system cartilage
strong strong
homogeneousstrong expression: see section 2 3 4 moderate expression: see section 5
larynx
strong strong
homogeneousstrong expression: see section 2 3 4 moderate expression: see section 5
trachea cartilaginous ring
strong strong
homogeneousstrong expression: see section 3 4
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3601
Entity Detected:Il16, interleukin 16 ( MGI:1270855)
Sequence:sense strand is shown

>T3601
GAGACAGACAGAGGTAGAGTCTATGTCCACAACCTTCCCTAACTCCTCAGAGGTCAGGGACCCAGGTTTG
CCTGAGTCTCCTCCCCCAGGTCAGCGACCCAGCACAAAAGCTTTGTCTCCAGACCCTCTCTTGAGACTGT
TGACTACACAATCCGAGGATACTCAAGGACCAGGTCTCAAGATGCCAAGTCAGCGGGCACGGAGCTTCCC
CCTGACCAGGACCCAGTCCTGCGAGACAAAGCTGTTGGATGAAAAGGCCAGTAAGCTTTACTCCATCAGC
AGCCAGCTATCATCTGCTGTCATGAAATCCCTGCTGTGCCTTCCATCTTCAGTCTCTTGTGGCCAGATCA
CCTGCATCCCCAAGGAGAGGGTGTCTCCAAAGTCACCTTGCAACAACAGCTCAGCTGCAGAGGGTTTTGG
TGAAGCCATGGCCTCTGACACAGGGTTCTCTCTCAACCTTTCAGAGCTGAGAGAATATTCAGAAGGTCTC
ACAGAGCCCGGGGAAACCGAGGACAGGAACCACTGTTCTTCTCAGGCC
Notes:The probe template was PCR amplified from IMAGE:3167627 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3167627 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000919 same experiment
 EMAGE:21378 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS