Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21398

Foxd1 forkhead box D1 ( MGI:1347463)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21398 EMAGE:21398 EMAGE:21398 EMAGE:21398 EMAGE:21398
euxassay_018971_01 euxassay_018971_02 euxassay_018971_03 euxassay_018971_04 euxassay_018971_05
EMAGE:21398 EMAGE:21398 EMAGE:21398 EMAGE:21398 EMAGE:21398
euxassay_018971_06 euxassay_018971_07 euxassay_018971_08 euxassay_018971_09 euxassay_018971_10
EMAGE:21398 EMAGE:21398 EMAGE:21398 EMAGE:21398 EMAGE:21398
euxassay_018971_11 euxassay_018971_12 euxassay_018971_13 euxassay_018971_14 euxassay_018971_15
EMAGE:21398 EMAGE:21398 EMAGE:21398 EMAGE:21398 EMAGE:21398
euxassay_018971_16 euxassay_018971_17 euxassay_018971_18 euxassay_018971_19 euxassay_018971_20
EMAGE:21398 EMAGE:21398 EMAGE:21398 EMAGE:21398
euxassay_018971_21 euxassay_018971_22 euxassay_018971_23 euxassay_018971_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21398Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21398_wholemount_strong.wlz
21398_wholemount_moderate.wlz
21398_wholemount_weak.wlz
21398_wholemount_possible.wlz
21398_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21398_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal cortex
weak weak
regionalweak expression: see section 9 0 1 8 9 0 1
vibrissa
strong strong
regionalstrong expression: see section 5 6 7 8 9 2 3 4 moderate expression: see section 1 weak expression: see section 0
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 2
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 1 2
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 3 4 5 6 7 8 9 9 0 1
tongue
moderate moderate
regionalmoderate expression: see section 3 4 7 8 weak expression: see section 1 2 5 6
upper lip
moderate moderate
regionalmoderate expression: see section 5 weak expression: see section 6
renal cortex
strong strong
regionalstrong expression: see section 8 9 0 1 2 8 9 0 1 2 3
male reproductive system
moderate moderate
regionalmoderate expression: see section 3 7
axial skeleton
moderate moderate
regionalmoderate expression: see section 0 1 2 3 4 7 8 9 weak expression: see section 8 9
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 4 5 6 7 8
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50405
Entity Detected:Foxd1, forkhead box D1 ( MGI:1347463)
Sequence:sense strand is shown

>T50405
CAAGGGACAGCGCTGTCCAGTGTGGAGAACTTTACTGCTAGGATTTCCAATTGTTAGGAACGTCGTTAGC
GCGCGGGAGAGCGAAGGTAGGACTCCCGGCTTCTTTCTCCGGATGGGGGGGTTGGTTTCGTTCGCCCCTC
CCGGTCCTCGGAGACCCCGCGCCCCCCGTTTTCGCCGCTTCGGATTCTTGGACCAGACTGTGTTGGGCGA
CAGCTGGGGCGCCGCGCAGTTTAGCTCAGAGGGTCCATCTATTTATGCAAAATCGCCCTATGCTGCAACC
CTGACTTGGGGTGGGAAGGAGGGGAGTCGCTCTGTCTTGGCACTAGGAATTTCCTTGACTTTTGACAAAT
TGAGAAAAAACAAAACAAAACAAGCAAAATCATCAAAACTAAGCCCTTTTTGAGGTGTAGAGATTCACAG
GTCCAGCGTTTTAAAAAATCAGTAATGTTTAAATGCAGCTTATAGAAAACCAGTAAAAGTCTCCAAGAAA
TGCCTCTACTTGTTCACACTTGTTTGGTAGACTTTTTTCATGGAAAGAAAAAAAATTAACATGTTTACAC
AAGAAATAAGTCGAAATTTACCATTTCCTATTTTTAACCTGTGTTTTGTATCATAATGGACATGCGGAAT
TTTTATTTTGTACTTACTACGTATTCTTTGCAAGGAGTATTGTAAATTTTACTGGCAATTATTATTGTAC
TATTCTAATGTAAGATTTTTACACTTTTTTTCAGAAATAAAATGCTTAATTT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:unspecified; Reverse Primer - name:unspecified, sequence:unspecified. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_018971 same experiment
 EMAGE:21400 same embryo
 EMAGE:21399 same embryo
 EMAGE:21402 same embryo
 EMAGE:21401 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS