Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21416

Ppp2r1a protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform ( MGI:1926334)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21416 EMAGE:21416 EMAGE:21416 EMAGE:21416 EMAGE:21416
euxassay_000885_01 euxassay_000885_02 euxassay_000885_03 euxassay_000885_04 euxassay_000885_05
EMAGE:21416 EMAGE:21416 EMAGE:21416 EMAGE:21416 EMAGE:21416
euxassay_000885_06 euxassay_000885_07 euxassay_000885_08 euxassay_000885_09 euxassay_000885_10
EMAGE:21416 EMAGE:21416 EMAGE:21416 EMAGE:21416 EMAGE:21416
euxassay_000885_11 euxassay_000885_12 euxassay_000885_13 euxassay_000885_14 euxassay_000885_15
EMAGE:21416 EMAGE:21416 EMAGE:21416 EMAGE:21416 EMAGE:21416
euxassay_000885_16 euxassay_000885_17 euxassay_000885_18 euxassay_000885_19 euxassay_000885_20
EMAGE:21416
euxassay_000885_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21416Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21416_wholemount_strong.wlz
21416_wholemount_moderate.wlz
21416_wholemount_weak.wlz
21416_wholemount_possible.wlz
21416_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21416_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 3 4 5 8
inferior glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 5 6 6
superior glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 5 6 6
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 3 4 5 6 7 8 9 5 6 7 8 9 0
vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 7 8 5
vestibulocochlear viii ganglion vestibular component
moderate moderate
homogeneousmoderate expression: see section 5 7
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 7 8 9 0 1 4 5 6 7
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1042
Entity Detected:Ppp2r1a, protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform ( MGI:1926334)
Sequence:sense strand is shown

>T1042
GTTGGCCTACTGGACCGCCCCGCCCGATCCCGGATTCCGCCTGGAGCTCGCTGCTGCCTGATAGAAACGC
CAGGGAGCCAAGATGGCAGCTGCCGACGGTGACGATTCGCTCTATCCTATTGCGGTGCTCATAGATGAAC
TCCGCAATGAAGACGTTCAGCTTCGTCTCAATAGTATCAAGAAGCTCTCCACAATTGCCTTGGCCCTTGG
GGTTGAACGGACCAGAAGTGAGCTCCTGCCCTTCCTTACAGATACCATTTATGATGAAGATGAGGTCCTC
TTGGCCTTGGCTGAACAGCTGGGAACCTTCACAACTTTGGTGGGAGGGCCTGAGTATGTGCACTGTCTGC
TGCCACCCCTTGAGTCACTGGCCACAGTGGAAGAGACAGTAGTGCGAGACAAGGCGGTAGAATCCTTGCG
GGCCATCTCTCATGAGCACTCACCTTCCGATCTAGAGGCTCACTTTGTGCCTCTGGTAAAGCGGCTGGCG
GGTGGAGACTGGTTCACCTCCCGCACCTCGGCCTGTGGTCTCTTCTCAGTTTGCTACCCCCGAGTATCCA
GTG
Notes:The probe template was PCR amplified from IMAGE:2088179 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2088179 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000885 same experiment
 EMAGE:21420 same embryo
 EMAGE:21419 same embryo
 EMAGE:21417 same embryo
 EMAGE:21418 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS