EMAGE mouse gene expression spatial database

EMAGE:21443

Atp6v1c2 ATPase, H+ transporting, lysosomal V1 subunit C2 ( MGI:1916025)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_000929. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_000929_01	euxassay_000929_02	euxassay_000929_03	euxassay_000929_04

euxassay_000929_05	euxassay_000929_06	euxassay_000929_07	euxassay_000929_08	euxassay_000929_09

euxassay_000929_10	euxassay_000929_11	euxassay_000929_12	euxassay_000929_13	euxassay_000929_14

euxassay_000929_15	euxassay_000929_16	euxassay_000929_17	euxassay_000929_18	euxassay_000929_19

euxassay_000929_20	euxassay_000929_21	euxassay_000929_22	euxassay_000929_23

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

nasal cavity olfactory epithelium

moderate

regional

moderate expression: see section 1 2 3 4 6 7 8 9 weak expression: see section 0

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T163
Entity Detected:	Atp6v1c2, ATPase, H+ transporting, lysosomal V1 subunit C2 ( MGI:1916025)
Sequence:	sense strand is shown >T163 CCAAATTGATCGCCGAGGACAACGAAGGTGGCCTCTTCACGGTGACTCTCTTCCGAAAAGTGATCGAAGA TTTCAAAGTCAAAGCCAAAGAAAACAAGTTCATTGTCCGGGAATTTTACTATGATGAAAAAGAAATTAAA CGAGAAAGGGAGGAGATGACCAGGTTGCTGTCTGATAAGAAACAACAGTATCCAACTTCCTGTGTTGCTC TAAAAAAGGGATCAGCCACCTACCGTGACCACAAGGTTAAGGTAGCCCCGCTAGGTAACCCTGCTAGGCC TGCTGCGGGGCAGACCGACAGAGACAGAGAGAGTGAGGGCGAGGGTGAGGGACCTCTGCTGCGCTGGCTC AAGGTGAACTTCAGCGAGGCCTTTATTGCCTGGATCCACATTAAGGCCCTGAGAGTGTTTGTGGAGTCTG TGCTCAGGTATGGACTTCCAGTGAACTTCCAGGCTGTGCTCCTACAGCCCCACAA
Notes:	The probe template was PCR amplified from IMAGE:2645167 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2645167 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_000929 same experiment
	EMAGE:21439 same embryo
	EMAGE:21441 same embryo
	EMAGE:21440 same embryo
	EMAGE:21442 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source