Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21469

St6galnac5 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5 ( MGI:1349471)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21469 EMAGE:21469 EMAGE:21469 EMAGE:21469 EMAGE:21469
euxassay_000951_01 euxassay_000951_02 euxassay_000951_03 euxassay_000951_04 euxassay_000951_05
EMAGE:21469 EMAGE:21469 EMAGE:21469 EMAGE:21469 EMAGE:21469
euxassay_000951_06 euxassay_000951_07 euxassay_000951_08 euxassay_000951_09 euxassay_000951_10
EMAGE:21469 EMAGE:21469 EMAGE:21469 EMAGE:21469 EMAGE:21469
euxassay_000951_11 euxassay_000951_12 euxassay_000951_13 euxassay_000951_14 euxassay_000951_15
EMAGE:21469 EMAGE:21469 EMAGE:21469 EMAGE:21469 EMAGE:21469
euxassay_000951_16 euxassay_000951_17 euxassay_000951_18 euxassay_000951_19 euxassay_000951_20
EMAGE:21469 EMAGE:21469 EMAGE:21469 EMAGE:21469
euxassay_000951_21 euxassay_000951_22 euxassay_000951_23 euxassay_000951_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21469Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21469_wholemount_strong.wlz
21469_wholemount_moderate.wlz
21469_wholemount_weak.wlz
21469_wholemount_possible.wlz
21469_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21469_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
cerebral cortex marginal layer
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 7 1 2 3 4 5 6 7 8 9 0 1 2 4 weak expression: see section 8 9 0
corpus striatum
moderate moderate
regionalmoderate expression: see section 1 2 3 5 6 9 0 1 2 weak expression: see section 6 7 8 9 0
telencephalon marginal layer
moderate moderate
regionalmoderate expression: see section 5 6 not examined expression: see section 1 2 3
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 6 7 8
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 1 2 3 5 6 1 6 7 8 1 2 4
medulla oblongata basal plate
moderate moderate
homogeneousmoderate expression: see section 7 8 9 0 1 4 6 7 8 weak expression: see section 2
cerebellum intraventricular portion mantle layer
moderate moderate
spottedmoderate expression: see section 5 9 1 weak expression: see section 4 6 9 0
cerebellum intraventricular portion ventricular layer
moderate moderate
spottedmoderate expression: see section 3 5 1 1 2 weak expression: see section 4 6 0 4 0
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 4 5 6 7 0 1 2 3
inferior glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 6 7 9
superior glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 6 7 9
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 3 4 5 6 7 9 9 0 1 2 3 4 weak expression: see section 8
inferior vagus x ganglion
weak weak
regionalweak expression: see section 9 8
superior vagus x ganglion
weak weak
regionalweak expression: see section 8 9 0 8 not examined expression: see section 9
ventral grey horn
weak weak
regionalweak expression: see section 9 0 1 2 4 5 6 7
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 7 8 weak expression: see section 9 0 1 2 3 9 0
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2111
Entity Detected:St6galnac5, ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5 ( MGI:1349471)
Sequence:sense strand is shown

>T2111
TGGCCTCGAGNCAGATTCGGACGAGGGGCAGCCAGAAGGAGCGGCCCCCGCAGCAGCAGCAGCAGCAGCA
GCAGCAGCAGCAGGCGGCAACCGCGACTGGCAGCACGCAGCTTGTGGAGAGCAGTCCCCAGCCACGTAGA
ACCGCCCCCGCAGGACCCCGGCAGCTCGAAGGATACCTCGGTGTAGCAGACCACAAGCCCCTGAAAATGC
ATTGCAAGGATTGCGCCCTGGTGACCAGCTCAGGGCATCTGCTGCGTAGTCAGCAGGGCCCCCACATCGA
CCAGACAGAGTGTGTTATCCGCATGAATGATGCCCCCACCCGAGGCTATGGGCTTGACGTGGGCAACCGC
ACGAGCCTGCGGGTCATCGCACATTCCAGCATCCAGAGGATCCTCCGCAACCGCCATGACCTGCTCAATG
TGAGCCAGGGCACCGTGTTCATCTTCTGGGGCCCCAGCAGCTACATGCGCCGGGATGGCAAGGGCCAGGC
GTACAACAACCTACAGCTCCTTAGCCAAGTGCTGCCTCGGCTGAAGGCCTTC
Notes:The probe template was PCR amplified from IMAGE:851226 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:851226 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000951 same experiment
 EMAGE:21467 same embryo
 EMAGE:21470 same embryo
 EMAGE:21466 same embryo
 EMAGE:21465 same embryo
 EMAGE:21468 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS