Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21472

Stambpl1 STAM binding protein like 1 ( MGI:1923880)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21472 EMAGE:21472 EMAGE:21472 EMAGE:21472 EMAGE:21472
euxassay_001020_01 euxassay_001020_02 euxassay_001020_03 euxassay_001020_04 euxassay_001020_05
EMAGE:21472 EMAGE:21472 EMAGE:21472 EMAGE:21472 EMAGE:21472
euxassay_001020_06 euxassay_001020_07 euxassay_001020_08 euxassay_001020_09 euxassay_001020_10
EMAGE:21472 EMAGE:21472 EMAGE:21472 EMAGE:21472 EMAGE:21472
euxassay_001020_11 euxassay_001020_12 euxassay_001020_13 euxassay_001020_14 euxassay_001020_15
EMAGE:21472 EMAGE:21472 EMAGE:21472 EMAGE:21472 EMAGE:21472
euxassay_001020_16 euxassay_001020_17 euxassay_001020_18 euxassay_001020_19 euxassay_001020_20
EMAGE:21472 EMAGE:21472 EMAGE:21472 EMAGE:21472
euxassay_001020_21 euxassay_001020_22 euxassay_001020_23 euxassay_001020_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21472Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21472_wholemount_strong.wlz
21472_wholemount_moderate.wlz
21472_wholemount_weak.wlz
21472_wholemount_possible.wlz
21472_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21472_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
limb
weak weak
regionalweak expression: see section 1 2 3 8 9 0 1 2 3 4
foregut-midgut junction
weak weak
regionalweak expression: see section 0 1 2 3 4 5 6 7 8
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 7 8 9
medulla oblongata basal plate
weak weak
regionalweak expression: see section 6 8 9 5 6 7
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 1 2 3
facial vii ganglion
weak weak
homogeneousweak expression: see section 3 4 5 9 0 1
glossopharyngeal ix ganglion
weak weak
homogeneousweak expression: see section 6 8
trigeminal v ganglion
weak weak
homogeneousweak expression: see section 2 3 4 5 6 7 6 7 8 9 0 1 2
vagus x ganglion
weak weak
homogeneousweak expression: see section 7 7
ventral grey horn
weak weak
regionalweak expression: see section 0 1 2 3 4 5
stomach
weak weak
regionalweak expression: see section 4 5 6 7
hindgut
weak weak
regionalweak expression: see section 0 1 2
midgut
weak weak
regionalweak expression: see section 4 5 6 7 8 9 0 1 2 3 4 5 6 7
lower jaw incisor
weak weak
regionalweak expression: see section 8 9 2 3 4
upper jaw incisor
weak weak
regionalweak expression: see section 8 9 0 1 2 3 4
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2309
Entity Detected:Stambpl1, STAM binding protein like 1 ( MGI:1923880)
Sequence:sense strand is shown

>T2309
TGGCCTCGAGGCCAGATTCGATCCTTGGTCGCAGTCGTCATCCCACACAAGCTCCGGACGCGCACGACTG
CTGGTGAGTGGCCCCACACGTGTGCCCGCTGGCCCCGAGATGAAGTGACTGAGAAGGAGTGAGCACCTTG
CCTTTGCAGACAGGACAGCATGGAGCAGCCATTCACTGTGAATTCACTGAAAAAGTTAGCTGCTATGCCT
GACCATACAGATGTTTCTCTAAGTCCAGAGGAGCGGGTCCGCGCCCTAAGCAAACTTGGTTGTAATATCT
CCATTAATGAAGATATCACCCCACGCCGTTACTTCAGGTCCGGAGTGGAAATGGAAAGGATGGCATCTGT
GTATTTGGAAGAAGGAAACCTGGAAAATGCCTTTGTTCTTTATAACAAATTTATAACGTTATTTGTAGAA
AAACTTCCCAGCCACCGAGATTACCAGCAGTGTGCAGTTCCAGAGAAGCAGGATATTATGAAGAAACTGA
AGGAGATTGCGTTCCCAAGGACAGACGAATTGAAAACGGACCTGCTAAGGAAATATAACATAGAATACCA
AGAGTATTTGC
Notes:The probe template was PCR amplified from IMAGE:1138874 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1138874 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001020 same experiment
 EMAGE:21473 same embryo
 EMAGE:21471 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS