Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21473

Arl5a ADP-ribosylation factor-like 5A ( MGI:1922673)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21473 EMAGE:21473 EMAGE:21473 EMAGE:21473 EMAGE:21473
"Pseudo-wholemount" of euxassay_000977. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000977_01 euxassay_000977_02 euxassay_000977_03 euxassay_000977_04
EMAGE:21473 EMAGE:21473 EMAGE:21473 EMAGE:21473 EMAGE:21473
euxassay_000977_05 euxassay_000977_06 euxassay_000977_07 euxassay_000977_08 euxassay_000977_09
EMAGE:21473 EMAGE:21473 EMAGE:21473 EMAGE:21473 EMAGE:21473
euxassay_000977_10 euxassay_000977_11 euxassay_000977_12 euxassay_000977_13 euxassay_000977_14
EMAGE:21473 EMAGE:21473 EMAGE:21473 EMAGE:21473 EMAGE:21473
euxassay_000977_15 euxassay_000977_16 euxassay_000977_17 euxassay_000977_18 euxassay_000977_19
EMAGE:21473 EMAGE:21473 EMAGE:21473 EMAGE:21473
euxassay_000977_20 euxassay_000977_21 euxassay_000977_22 euxassay_000977_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21473Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21473_wholemount_strong.wlz
21473_wholemount_moderate.wlz
21473_wholemount_weak.wlz
21473_wholemount_possible.wlz
21473_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21473_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate
weak weak
homogeneousweak expression: see section 6 7 3 4
facial vii ganglion
weak weak
homogeneousweak expression: see section 2 3 4 8 9
inferior glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 5 weak expression: see section 4 6 7
superior glossopharyngeal ix ganglion
weak weak
homogeneousweak expression: see section 5 6 7
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 5 weak expression: see section 1 2 3 4 6 6 7 8 9 0
not examined not examined
homogeneousnot examined expression: see section 5
superior vagus x ganglion
weak weak
homogeneousweak expression: see section 6 not examined expression: see section 5
vestibulocochlear viii ganglion cochlear component
moderate moderate
homogeneousmoderate expression: see section 5 6 weak expression: see section 4 7
vestibulocochlear viii ganglion vestibular component
moderate moderate
homogeneousmoderate expression: see section 5 6 weak expression: see section 4 7
liver lobe
moderate moderate
homogeneousmoderate expression: see section 1 2 3 4 5 6 7 8 9 0 2 3 4 5 6 7 8 0 1 2 weak expression: see section 9 3
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1579
Entity Detected:Arl5a, ADP-ribosylation factor-like 5A ( MGI:1922673)
Sequence:sense strand is shown

>T1579
CAGAAATCTCCCAGTTTTTGAAGCTTACTTCTATAAAAGACCACCAGTGGCATATTCAAGCATGTTGCGC
TCTTACTGGCGAGGGGTTATGCCAAGGACTTGAATGGATGATGTCACGGCTGAAGATCAGATGATCTCTT
CTGACCCCTCCTCACAGACTCTGTATAAAGAAAGTGCTGGACTTTTCCTGAAAGCTGCAAAAAAATGGTT
TAGATATATTTATAATAAACTGACTTAAGAGTTTTCTATAAGAAGAAAATTAAGACCACTTATTTGAAAA
CAAAGATGAAATGTCACCACCCGTTTGCGCTCTCATTCCTTCCAAGCCTGTGACTGGTATTTTCTCATGA
TGAATCCTCTCAGGACATGGCAGAGCTTGGCGAGTACAAAGGGAGAGGAAGACATTTGAACTTTAGAACT
TTGTTTCAGCGTGACTCTCCCACCCTGCCCCAAGTTGAATGTTCCCTTCACATTGAATCAAATACAAATC
AGCACAGATACTGTTTCCAGTTTTTAAAAA
Notes:The probe template was PCR amplified from IMAGE:934823 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:934823 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000977 same experiment
 EMAGE:21472 same embryo
 EMAGE:21471 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS