Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21479

Ephx1 epoxide hydrolase 1, microsomal ( MGI:95405)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21479 EMAGE:21479 EMAGE:21479 EMAGE:21479 EMAGE:21479
euxassay_000879_01 euxassay_000879_02 euxassay_000879_03 euxassay_000879_04 euxassay_000879_05
EMAGE:21479 EMAGE:21479 EMAGE:21479 EMAGE:21479 EMAGE:21479
euxassay_000879_06 euxassay_000879_07 euxassay_000879_08 euxassay_000879_09 euxassay_000879_10
EMAGE:21479 EMAGE:21479 EMAGE:21479 EMAGE:21479 EMAGE:21479
euxassay_000879_11 euxassay_000879_12 euxassay_000879_13 euxassay_000879_14 euxassay_000879_15
EMAGE:21479 EMAGE:21479 EMAGE:21479 EMAGE:21479
euxassay_000879_16 euxassay_000879_17 euxassay_000879_18 euxassay_000879_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21479Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21479_wholemount_strong.wlz
21479_wholemount_moderate.wlz
21479_wholemount_weak.wlz
21479_wholemount_possible.wlz
21479_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21479_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 3 4 weak expression: see section 4 2 3
lateral ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 3 4 5 6 9 1 2 3 4 weak expression: see section 7 8
4th ventricle
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 7 8 0 1 2 weak expression: see section 9 3 4 5 6 7
inferior glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 3 weak expression: see section 4
superior glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 3 weak expression: see section 4
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 1 2 3 weak expression: see section 4 4 5 6 7 8
vagus x ganglion
weak weak
homogeneousweak expression: see section 4
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 3 4 5 6 7 0 1 2 3 4
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T982
Entity Detected:Ephx1, epoxide hydrolase 1, microsomal ( MGI:95405)
Sequence:sense strand is shown

>T982
TCCTCGAGNCTGTTGGCCTACTGGAAAGAGGCTCAAGAGGAGTTTGAGAGTGGAGGAACTGCACACCAGC
CGCCGCGGGAGTAGGAACCCGAGAGCGACCCTGACAGAGTCATGTGGCTGGAACTCATCCTGGCTTCTGT
GCTGGGCTTTGTCATCTACTGGTTTGTCTCCCGGGACAAGGAGGAGACCTTACCACTTGAAGATGGGTGG
TGGGGCCCAGGGTCAAAGCCATCAGCCAAAGAAGATGAGAGCATCCGGCCCTTCAAGGTGGAAACATCAG
ATGAGGAGATCAAGGACTTGCACCAGAGGATAGATAGGTTCCGGGCATCCCCACCTTTGGAGGGCAGTCG
CTTCCACTATGGCTTCAACTCCAGCTACCTGAAGAAAGTGGTGTCCTTCTGGAGGAATGAGTTTGACTGG
AGGAAGCAGGTGGAGATCCTCAACCAATACCCACACTTTAAGACCAAGATTGAAGGGCTGGACATCCACT
TCATCCACGTGAAACCTCCCCAGCTGCCCTCAGGCCGCACTCCAAAGCC
Notes:The probe template was PCR amplified from IMAGE:1972503 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1972503 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000879 same experiment
 EMAGE:21477 same embryo
 EMAGE:21476 same embryo
 EMAGE:21478 same embryo
 EMAGE:21475 same embryo
 EMAGE:21474 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS