Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21495

Sparc secreted acidic cysteine rich glycoprotein ( MGI:98373)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21495 EMAGE:21495 EMAGE:21495 EMAGE:21495 EMAGE:21495
euxassay_002868_01 euxassay_002868_02 euxassay_002868_03 euxassay_002868_04 euxassay_002868_05
EMAGE:21495 EMAGE:21495 EMAGE:21495 EMAGE:21495 EMAGE:21495
euxassay_002868_06 euxassay_002868_07 euxassay_002868_08 euxassay_002868_09 euxassay_002868_10
EMAGE:21495 EMAGE:21495 EMAGE:21495 EMAGE:21495 EMAGE:21495
euxassay_002868_11 euxassay_002868_12 euxassay_002868_13 euxassay_002868_14 euxassay_002868_15
EMAGE:21495 EMAGE:21495 EMAGE:21495 EMAGE:21495 EMAGE:21495
euxassay_002868_16 euxassay_002868_17 euxassay_002868_18 euxassay_002868_19 euxassay_002868_20
EMAGE:21495 EMAGE:21495 EMAGE:21495
euxassay_002868_21 euxassay_002868_22 euxassay_002868_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21495Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21495_wholemount_strong.wlz
21495_wholemount_moderate.wlz
21495_wholemount_weak.wlz
21495_wholemount_possible.wlz
21495_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21495_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1764
Entity Detected:Sparc, secreted acidic cysteine rich glycoprotein ( MGI:98373)
Sequence:sense strand is shown

>T1764
CNGTGAGAATGAGCGCCTGGAGGCTGGAGACCACCCCGTGGAGCTGTTGGCCCGAGACTTTGAGAAGAAC
TACAATATGTACATCTTCCCTGTCCACTGGCAGTTTGGCCAGCTGGATCAGCACCCTATTGATGGGTACC
TGTCCCACACTGAGCTGGCCCCACTGCGCGCTCCCCTCATCCCCATGGAACATTGCACCACACGTTTCTT
TGAGACCTGTGACCTAGACAACGACAAGTACATTGCCCTGAAGGAATGGGCCGGCTGCTTTGGCATCAAN
GAGCAGGACATCAACAAGGATCTGGTGATCTAAGTTCACG
Notes:The probe template was PCR amplified from IMAGE:483759 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:483759 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002868 same experiment
 EMAGE:21496 same embryo
 EMAGE:21492 same embryo
 EMAGE:21497 same embryo
 EMAGE:21493 same embryo
 EMAGE:21494 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS