Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21587

P2rx4 purinergic receptor P2X, ligand-gated ion channel 4 ( MGI:1338859)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21587 EMAGE:21587 EMAGE:21587 EMAGE:21587 EMAGE:21587
"Pseudo-wholemount" of euxassay_001944. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001944_01 euxassay_001944_02 euxassay_001944_03 euxassay_001944_04
EMAGE:21587 EMAGE:21587 EMAGE:21587 EMAGE:21587 EMAGE:21587
euxassay_001944_05 euxassay_001944_06 euxassay_001944_07 euxassay_001944_08 euxassay_001944_09
EMAGE:21587 EMAGE:21587 EMAGE:21587 EMAGE:21587 EMAGE:21587
euxassay_001944_10 euxassay_001944_11 euxassay_001944_12 euxassay_001944_13 euxassay_001944_14
EMAGE:21587 EMAGE:21587 EMAGE:21587 EMAGE:21587 EMAGE:21587
euxassay_001944_15 euxassay_001944_16 euxassay_001944_17 euxassay_001944_18 euxassay_001944_19
EMAGE:21587 EMAGE:21587 EMAGE:21587 EMAGE:21587
euxassay_001944_20 euxassay_001944_21 euxassay_001944_22 euxassay_001944_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21587Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21587_wholemount_strong.wlz
21587_wholemount_moderate.wlz
21587_wholemount_weak.wlz
21587_wholemount_possible.wlz
21587_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21587_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3
vibrissa
moderate moderate
regionalmoderate expression: see section 5 6 7 1 2
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 0 1 moderate expression: see section 2 3
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 0 1 2
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 7 8 9 0 1
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 7 8 9 0 1
pons ventricular layer
strong strong
regionalstrong expression: see section 3 4 5 6 7 8 9 1 2 3 4 5 6
midbrain ventricular layer
strong strong
regionalstrong expression: see section 5 6 7 8 9 0 1 2 3
nasal septum
moderate moderate
regionalmoderate expression: see section 8 9 0 1 2 3 4 5 6 7 8 9
orbito-sphenoid
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2
viscerocranium
strong strong
regionalstrong expression: see section 7 8 9 0 1 6
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T616
Entity Detected:P2rx4, purinergic receptor P2X, ligand-gated ion channel 4 ( MGI:1338859)
Sequence:sense strand is shown

>T616
TCCTCGAGNCTGTTGGCCTACTGGCTACAGGGACCTTGCTGGCAATGAGCAACGCACACTCACCAAGGCA
TATGGCATCCGCTTTGACATCATCGTGTTTGGAAAGGCTGGCAAGTTTGACATCATCCCAACCATGATCA
ATGTTGGCTCTGGCTTGGCGCTCCTAGGGGTGGCGACCGTGCTGTGTGACGTCATAGTCCTCTACTGTAT
GAAGAAGAGATACTACTACCGGGACAAGAAATATAAGTATGTGGAAGACTACGAGCAGGGTCTTTCCGGA
GAGACGGACCAGTGATGCCTAACCCTACATTTCAATCCCACTCAGCCTGTGATGCAGAAATATGGGAGAC
TTGGCTGCTGCGTCTGTCACTCTAGAGACGGTTCCAGAGTCTCACTCGGTCTCCACTCCACAAATACTCA
GGGTTGCCCGAGCACGTCTTGTATTGTTTTTTTGTGGGTTTTGAGCCCGGGTCCTGCTCTGCAGCCCAGA
TGGGCTTCAGATTCAAGATCCTCCTGCTTCAACCTCCAGGGGTGCTGGAATCCCACAC
Notes:The probe template was PCR amplified from IMAGE:1886095 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1886095 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001944 same experiment
 EMAGE:21590 same embryo
 EMAGE:21588 same embryo
 EMAGE:21586 same embryo
 EMAGE:21589 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS