Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21639

Capza2 capping protein (actin filament) muscle Z-line, alpha 2 ( MGI:106222)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21639 EMAGE:21639 EMAGE:21639 EMAGE:21639 EMAGE:21639
"Pseudo-wholemount" of euxassay_003331. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003331_01 euxassay_003331_02 euxassay_003331_03 euxassay_003331_04
EMAGE:21639 EMAGE:21639 EMAGE:21639 EMAGE:21639 EMAGE:21639
euxassay_003331_05 euxassay_003331_06 euxassay_003331_07 euxassay_003331_08 euxassay_003331_09
EMAGE:21639 EMAGE:21639 EMAGE:21639 EMAGE:21639 EMAGE:21639
euxassay_003331_10 euxassay_003331_11 euxassay_003331_12 euxassay_003331_13 euxassay_003331_14
EMAGE:21639 EMAGE:21639 EMAGE:21639 EMAGE:21639 EMAGE:21639
euxassay_003331_15 euxassay_003331_16 euxassay_003331_17 euxassay_003331_18 euxassay_003331_19
EMAGE:21639 EMAGE:21639 EMAGE:21639 EMAGE:21639
euxassay_003331_20 euxassay_003331_21 euxassay_003331_22 euxassay_003331_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21639Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21639_wholemount_strong.wlz
21639_wholemount_moderate.wlz
21639_wholemount_weak.wlz
21639_wholemount_possible.wlz
21639_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21639_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 3 4 5 6 7
submandibular gland primordium
weak weak
regionalweak expression: see section 8 9 0 1 9 0
vibrissa
weak weak
regionalweak expression: see section 5 6 7 0 1
medulla oblongata basal plate
moderate moderate
regionalmoderate expression: see section 9 0 1 7 8
metencephalon basal plate
moderate moderate
regionalmoderate expression: see section 8 8
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 8 9 0 9 0
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 4 5 6 7 8 9 0 8 9 0 1 2
ventral grey horn
moderate moderate
regionalmoderate expression: see section 2 3 5 8 9 weak expression: see section 4
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 9 0 1 3 4 8 9 weak expression: see section 2 0
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6378
Entity Detected:Capza2, capping protein (actin filament) muscle Z-line, alpha 2 ( MGI:106222)
Sequence:sense strand is shown

>T6378
CTCCCAAATTTTCTAATTTACAACTTGTTAAGAATGACAATATACAAAGAAAGTATTTTAAAATAGTGTA
TGATTCACTGGTGATTTTTTTTTTACTCAAATAAATACCAAATGTTGCCATTTTAATGTCACACTGATAT
TCAGTTTCCAATCCAAGGGGAGGGAGAATCAACTGAGACATGTTCATGAGTTCAGGATTATATATATATT
ACAATCTGCCTTATAATACACTTGTGGCTTTGTGATAAAAATAACTCAGGAACATATGGAATTCAAGCTA
ATTTGCATAACTGTCACAAGAAAAAAGCATTAAATGCATTTCTGAAATAAGTATTCTCATTTAATTTCAG
AATCTCAAAACAGCAACAGACCTTGGCCTTGTTTTAAAAAAGTTTAGTTAGACACTAAGCTAGCTAAATA
ACCTTGCTGAGAAGGTTTAACGTAACTCGTTAGAAAATGCTCTCCCTCTAATCTCCATCTTCCATGCTGG
AAGAGGTGAAAGGAAAAGGTAGACAATTTCTTTAGCAGCATACATGGCTAAGTCCATCAACCACCTTAAC
TAGAGTGCCCATTACTGACTGACCCCACTAA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GAATGCATAAATGAAAATTGC; Reverse Primer - name:unspecified, sequence:TTATGATGCATAGGAAAATGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_003331 same experiment
 EMAGE:21641 same embryo
 EMAGE:21640 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS