Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21644

Insm1 insulinoma-associated 1 ( MGI:1859980)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21644 EMAGE:21644 EMAGE:21644 EMAGE:21644 EMAGE:21644
"Pseudo-wholemount" of euxassay_019598. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019598_01 euxassay_019598_02 euxassay_019598_03 euxassay_019598_04
EMAGE:21644 EMAGE:21644 EMAGE:21644 EMAGE:21644 EMAGE:21644
euxassay_019598_05 euxassay_019598_06 euxassay_019598_07 euxassay_019598_08 euxassay_019598_09
EMAGE:21644 EMAGE:21644 EMAGE:21644 EMAGE:21644 EMAGE:21644
euxassay_019598_10 euxassay_019598_11 euxassay_019598_12 euxassay_019598_13 euxassay_019598_14
EMAGE:21644 EMAGE:21644 EMAGE:21644 EMAGE:21644 EMAGE:21644
euxassay_019598_15 euxassay_019598_16 euxassay_019598_17 euxassay_019598_18 euxassay_019598_19
EMAGE:21644 EMAGE:21644 EMAGE:21644 EMAGE:21644
euxassay_019598_20 euxassay_019598_21 euxassay_019598_22 euxassay_019598_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21644Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21644_wholemount_strong.wlz
21644_wholemount_moderate.wlz
21644_wholemount_weak.wlz
21644_wholemount_possible.wlz
21644_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21644_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
weak weak
regionalweak expression: see section 8 9 0 6 7 8
pancreas
moderate moderate
regionalmoderate expression: see section 9 weak expression: see section 0 2 7
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 4 weak expression: see section 2 3
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 0 1 5 6
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 4 weak expression: see section 2 3
olfactory cortex ventricular layer
strong strong
regionalstrong expression: see section 7 moderate expression: see section 1 2 3 8
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 6 7 0 1 moderate expression: see section 5 6 7 8 9 0 1 2 3 5 8 9 2 weak expression: see section 3 4 3
metencephalon rest of alar plate marginal layer
strong strong
regionalstrong expression: see section 5 6 9 0 2 3 4 6 7 8 moderate expression: see section 8 0 1 2 weak expression: see section 4 7 1 5 9
midbrain ventricular layer
strong strong
regionalstrong expression: see section 6 7 moderate expression: see section 7 8 9 0 2 3 4 5 weak expression: see section 1
neural retina
moderate moderate
regionalmoderate expression: see section 1 5 weak expression: see section 2 3 4
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 9 0 2 3 4 6 7 8 0 1 moderate expression: see section 1 9
vomeronasal organ
strong strong
regionalstrong expression: see section 3 4 6
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55087
Entity Detected:Insm1, insulinoma-associated 1 ( MGI:1859980)
Sequence:sense strand is shown

>T55087
GGTCTTCTCGCTGTGACTCCTTTGGACCCCAACCCCTTTGCGTTGTGCCCCCCCCCCCAAGCCCCATGGC
GCAACAGGAGTCCGTCTCTTTCTGTACAGGGGAGGAAAAAAATGCTGTATACGTTTGTCTCGTGGTTGGA
CGCCTCCTTTTGAGGGGCAAAGCTGTTTTTCTTGCTAGTATTCGCTGTGTTCATGGTCTAGAAAATGCGG
TTTGCTCTGCCTACCAATCTCTGCTCTCTATGTCTGTAGCGTACGGGTTGTTTTGGGTGAATCTTGAGGA
ATAAAATGCCTTTATATTTCACAGGCTGTAAATTGAACTTCCCACACGATTAGCTTTATTATGGCTTGTG
AACTGCTGGAGTCTGGCTTTACCTTTTTGTATGTGAACAAATCAAATTGCTTAAAAAAGAGTTTTCTTTA
GTATAGCCACAAATGCCTTGACCTGTTGTCTGTTGGGGATT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GGTCTTCTCGCTGTGACTCC; Reverse Primer - name:unspecified, sequence:AATCCCCAACAGACAACAGG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_019598 same experiment
 EMAGE:21646 same embryo
 EMAGE:21645 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS