Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21658

Ttyh1 tweety homolog 1 (Drosophila) ( MGI:1889007)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21658 EMAGE:21658 EMAGE:21658 EMAGE:21658 EMAGE:21658
"Pseudo-wholemount" of euxassay_005646. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005646_01 euxassay_005646_02 euxassay_005646_03 euxassay_005646_04
EMAGE:21658 EMAGE:21658 EMAGE:21658 EMAGE:21658 EMAGE:21658
euxassay_005646_05 euxassay_005646_06 euxassay_005646_07 euxassay_005646_08 euxassay_005646_09
EMAGE:21658 EMAGE:21658 EMAGE:21658 EMAGE:21658 EMAGE:21658
euxassay_005646_10 euxassay_005646_11 euxassay_005646_12 euxassay_005646_13 euxassay_005646_14
EMAGE:21658 EMAGE:21658 EMAGE:21658 EMAGE:21658 EMAGE:21658
euxassay_005646_15 euxassay_005646_16 euxassay_005646_17 euxassay_005646_18 euxassay_005646_19
EMAGE:21658 EMAGE:21658 EMAGE:21658 EMAGE:21658
euxassay_005646_20 euxassay_005646_21 euxassay_005646_22 euxassay_005646_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21658Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21658_wholemount_strong.wlz
21658_wholemount_moderate.wlz
21658_wholemount_weak.wlz
21658_wholemount_possible.wlz
21658_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21658_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
pancreas
moderate moderate
regionalmoderate expression: see section 0 1 5 6
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 1 2 3 4 5
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 moderate expression: see section 2 3
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 5 6 7 8 9 0 1 2 3 4
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8
pons ventricular layer
strong strong
regionalstrong expression: see section 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8
midbrain ventricular layer
strong strong
regionalstrong expression: see section 5 6 7 8 9 0 1 2 3
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 3
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 4 5 4 5
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 2 3 4 5 6 7 8 5 6 7 8 9 0
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 5 4
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 3 4 5 6 7 8 9 0
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 7 8 9
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 5 weak expression: see section 6 1
cervical ganglion
moderate moderate
regionalmoderate expression: see section 5 weak expression: see section 6 3 4
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6323
Entity Detected:Ttyh1, tweety homolog 1 (Drosophila) ( MGI:1889007)
Sequence:sense strand is shown

>T6323
TCTCACTTAGGATGGCAACCTGCTCTGGCCCTAACACCCACCCCCCCATCCCCATTTCTCCTTAGCACAG
GGGATTGCTGAGGTGGCACAACAGGGACCAGGGGTGGCTGGGAAGGGGGCTGACCTATACAGCCTGGTGT
TCCTCACCTCTGGCTGCCAGTCCTGTCCTTGGAGGGATGAAGCTGGAGGCAGGTACAGGCACGTCCCTGT
TTCCTGCCATACCCCAGCGATCTCAACCTATGGCACTAACTTGGAAGAGGGCTGATTTGAAATAAAAGGG
AAGGCTTTATTTTACAAGCAGCTAGGTCCTTCTTATCCACCCCAACTACTGAGAGAAGGAAGTCCTGACT
GGGCTAGGGACACTCCTCCTCTGGTGGTTGAAAGGCAACTCTCCTCTTGTCCAGGCTCAGCACTGCATTG
CTTCTATAAGTAACATGTGAATCCTGACAAGGGGGAAGAAGCAGATACCGGAAGAGAATAAGCCTAGCAC
TAAATCTAAACAGGCGTGCAGCCACAGGAACAGTCAAGCTTCCAGTCCCGTGGAATGTACAAAGCCTGCT
GGGTTTAGGAAAGGCGTGGAATCAACTTGCTTCCTAGCAGCTCACACC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:ACTAACCTGACCTTGACTGG; Reverse Primer - name:unspecified, sequence:CTCTGCCATGTTTGTTTTTAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_005646 same experiment
 EMAGE:21659 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS