Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21660

Myh6 myosin, heavy polypeptide 6, cardiac muscle, alpha ( MGI:97255)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21660 EMAGE:21660 EMAGE:21660 EMAGE:21660 EMAGE:21660
"Pseudo-wholemount" of euxassay_018788. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018788_01 euxassay_018788_02 euxassay_018788_03 euxassay_018788_04
EMAGE:21660 EMAGE:21660 EMAGE:21660 EMAGE:21660 EMAGE:21660
euxassay_018788_05 euxassay_018788_06 euxassay_018788_07 euxassay_018788_08 euxassay_018788_09
EMAGE:21660 EMAGE:21660 EMAGE:21660 EMAGE:21660 EMAGE:21660
euxassay_018788_10 euxassay_018788_11 euxassay_018788_12 euxassay_018788_13 euxassay_018788_14
EMAGE:21660 EMAGE:21660 EMAGE:21660 EMAGE:21660 EMAGE:21660
euxassay_018788_15 euxassay_018788_16 euxassay_018788_17 euxassay_018788_18 euxassay_018788_19
EMAGE:21660 EMAGE:21660 EMAGE:21660 EMAGE:21660 EMAGE:21660
euxassay_018788_20 euxassay_018788_21 euxassay_018788_22 euxassay_018788_23 euxassay_018788_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21660Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21660_wholemount_strong.wlz
21660_wholemount_moderate.wlz
21660_wholemount_weak.wlz
21660_wholemount_possible.wlz
21660_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21660_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diaphragm
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 moderate expression: see section 7 8 4 6
vertebral axis musculature
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4
extrinsic ocular muscle
strong strong
regionalstrong expression: see section 1 2 3 6 7 8 9 moderate expression: see section 4 5 6 0 1
heart atrium
strong strong
homogeneousstrong expression: see section 4 5 6 7 8 9 0 1 2 3 4 5 6 7
heart ventricle
strong strong
homogeneousstrong expression: see section 5 6 7 8 9 0 1 2 3 4
tongue muscle
strong strong
regionalstrong expression: see section 8 9 0 1 2 3 moderate expression: see section 7
tail mesenchyme
strong strong
regionalstrong expression: see section 7 8 9 0 1
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50700
Entity Detected:Myh6, myosin, heavy polypeptide 6, cardiac muscle, alpha ( MGI:97255)
Sequence:sense strand is shown

>T50700
GGTCCACATTCTTCAGGATTCTCTGAAAAGTTAACCAGAGTTTGAGTGACAGAATGACGGACGCCCAGAT
GGCTGACTTCGGGGCAGCAGCCCAGTACCTCCGAAAGTCAGAGAAGGAACGCCTAGAGGCCCAGACACGG
CCCTTTGACATCCGCACGGAGTGCTTCGTGCCTGATGACAAGGAGGAGTATGTTAAGGCCAAGGTCGTGT
CCCGGGAAGGGGGCAAAGTCACTGCGGAAACTGAAAACGGAAAGACGGTGACCATAAAGGAGGACCAGGT
GATGCAGCAGAACCCACCCAAGTTCGACAAGATCGAGGACATGGCCATGCTGACCTTCCTGCACGAGCCG
GCTGTGCTGTACAACCTCAAGGAGCGCTACGCGGCCTGGATGATCTATACCTACTCGGGCCTCTTCTGCG
TCACCGTCAACCCCTACAAGTGGCTGCCAGTGTACAATGCGGAAGTG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:unspecified; Reverse Primer - name:unspecified, sequence:unspecified. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:BL6/SV129
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_018788 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS