Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21689

Pax6 paired box gene 6 ( MGI:97490)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21689 EMAGE:21689 EMAGE:21689 EMAGE:21689 EMAGE:21689
"Pseudo-wholemount" of euxassay_017942. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_017942_01 euxassay_017942_02 euxassay_017942_03 euxassay_017942_04
EMAGE:21689 EMAGE:21689 EMAGE:21689 EMAGE:21689 EMAGE:21689
euxassay_017942_05 euxassay_017942_06 euxassay_017942_07 euxassay_017942_08 euxassay_017942_09
EMAGE:21689 EMAGE:21689 EMAGE:21689 EMAGE:21689 EMAGE:21689
euxassay_017942_10 euxassay_017942_11 euxassay_017942_12 euxassay_017942_13 euxassay_017942_14
EMAGE:21689 EMAGE:21689 EMAGE:21689 EMAGE:21689 EMAGE:21689
euxassay_017942_15 euxassay_017942_16 euxassay_017942_17 euxassay_017942_18 euxassay_017942_19
EMAGE:21689 EMAGE:21689 EMAGE:21689 EMAGE:21689 EMAGE:21689
euxassay_017942_20 euxassay_017942_21 euxassay_017942_22 euxassay_017942_23 euxassay_017942_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21689Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21689_wholemount_strong.wlz
21689_wholemount_moderate.wlz
21689_wholemount_weak.wlz
21689_wholemount_possible.wlz
21689_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21689_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pericardium
moderate moderate
spottedmoderate expression: see section 7 8 9 0 1 2 3 4 5 6
pancreas
strong strong
regionalstrong expression: see section 1 2
pituitary gland
moderate moderate
regionalmoderate expression: see section 9 0 1 weak expression: see section 2 3 4 5
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 7
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 9 0 1 4
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 8 9 0 1 2 4 5 6 7 8
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 1 2 3 4
telencephalon mantle layer
strong strong
regionalstrong expression: see section 2 3 4 5 6 9 0 2 3 4 5 6 7 8 9 0 1 2
olfactory cortex ventricular layer
strong strong
regionalstrong expression: see section 7 8 2 3
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 2 3 4 5 6 7 8 9 0 2 3 4 5 6 7 8 9 0 1 2 3 4
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 0 1 2 5 6
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 8 9 0 1 2 3 4 5 6 7 8
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 9
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 5 6 7 8 0 1 2 5 6 7 8 9 0 1 2 3 moderate expression: see section 3
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 5 6 7 1 2 3 moderate expression: see section 9 weak expression: see section 8
pons mantle layer
moderate moderate
regionalmoderate expression: see section 9
pons ventricular layer
strong strong
regionalstrong expression: see section 0 1 2 5 6 7 8 moderate expression: see section 9 3 9 weak expression: see section 8
midbrain mantle layer
strong strong
regionalstrong expression: see section 0 1 2 6 7 8
ventral grey horn
strong strong
single cellstrong expression: see section 5 6 7 8 9 0 1 2 3 4 5 6
intermediate grey horn
strong strong
single cellstrong expression: see section 5 6 9 0 1 2 3 4
spinal cord ventricular layer
strong strong
single cellstrong expression: see section 7 8 9 0 1 2 3 4
cornea epithelium
strong strong
regionalstrong expression: see section 1 0 1 2 3 4
neural retina
strong strong
regionalstrong expression: see section 1 2 0 1 2 3 4
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 5 6 5 6 moderate expression: see section 7 9 0 1 2 4 weak expression: see section 8 3
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 1 2 weak expression: see section 8 9
lung
moderate moderate
regionalmoderate expression: see section 2 3 4 6 7 4 weak expression: see section 5 8 9 2 3 5 6 7 8
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50782
Entity Detected:Pax6, paired box gene 6 ( MGI:97490)
Sequence:sense strand is shown

>T50782
AGTTCTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCAGACGGCATGTATGATAAACTAAGGATG
TTGAACGGGCAGACCGGAAGCTGGGGCACACGCCCTGGTTGGTATCCCGGGACTTCAGTACCAGGGCAAC
CCACGCAAGATGGCTGCCAGCAACAGGAAGGAGGGGGAGAGAACACCAACTCCATCAGTTCTAACGGAGA
AGACTCGGATGAAGCTCAGATGCGACTTCAGCTGAAGCGGAAGCTGCAAAGAAATAGAACATCTTTTACC
CAAGAGCAGATTGAGGCTCTGGAGAAAGAGTTTGAGAGGACCCATTATCCAGATGTGTTTGCCCGGGAAA
GACTAGCAGCCAAAATAGATCTACCTGAAGCAAGAATACAGGTATGGTTTTCTAATCGAAGGGCCAAATG
GAGAAGAGAAGAGAAACTGAGGAACCAGAGAAGACAGGCCAGCAACACTCCTAGTCACATTCCTATCAGC
AGCAGCTTCAGTACCAGTGTCTACCAGCCAATCCCACAGCCCACCACACCTGTCTCCTCCTTCACATCAG
GTTCCATGTTGGGCCGAACAGACACCGCCCTCACCAACACGTACAGTGCTTTGCCACCCATGCCCAGCTT
CACCATGGCAAACAACCTGCCTATGCAACCCCCAGTCCCCAGTCAGACCTCCTCATACTCGTGCATGCTG
CCCACCAGCCCGTCAGTGAATGGGCGGAGTTATGATACCTACACCCCTCCGCACATGCAAACACACATGA
ACAGTCAGCCCATGGGCACCTCGGGGACCACTTCAACAGGACTCATTTCACCTGGAGTGTCAGTTCCCGT
CCAAGT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AGTTCTTCGCAACCTGGCTA; Reverse Primer - name:unspecified, sequence:ACTTGGACGGGAACTGACAC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_017942 same experiment
 EMAGE:21688 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS