Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21707

Gli3 GLI-Kruppel family member GLI3 ( MGI:95729)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21707 EMAGE:21707 EMAGE:21707 EMAGE:21707 EMAGE:21707
"Pseudo-wholemount" of euxassay_018378. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018378_01 euxassay_018378_02 euxassay_018378_03 euxassay_018378_04
EMAGE:21707 EMAGE:21707 EMAGE:21707 EMAGE:21707 EMAGE:21707
euxassay_018378_05 euxassay_018378_06 euxassay_018378_07 euxassay_018378_08 euxassay_018378_09
EMAGE:21707 EMAGE:21707 EMAGE:21707 EMAGE:21707 EMAGE:21707
euxassay_018378_10 euxassay_018378_11 euxassay_018378_12 euxassay_018378_13 euxassay_018378_14
EMAGE:21707 EMAGE:21707 EMAGE:21707 EMAGE:21707 EMAGE:21707
euxassay_018378_15 euxassay_018378_16 euxassay_018378_17 euxassay_018378_18 euxassay_018378_19
EMAGE:21707 EMAGE:21707 EMAGE:21707 EMAGE:21707 EMAGE:21707
euxassay_018378_20 euxassay_018378_21 euxassay_018378_22 euxassay_018378_23 euxassay_018378_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21707Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21707_wholemount_strong.wlz
21707_wholemount_moderate.wlz
21707_wholemount_weak.wlz
21707_wholemount_possible.wlz
21707_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21707_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 3 4 5 6
forelimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 3 4 5 6
forelimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 3 4 5
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 1
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 8
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 8 9
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 8 9 0 1
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 9 0 1
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 9 0 1
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 7 weak expression: see section 6
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 5 6 7
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 6 7 8
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 5 6 1 2 3
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 5 6 7 8 9 0 1 3 4 5 6 7 8 0 1 2 3 4 weak expression: see section 2
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 8 9 0 1 3 4 weak expression: see section 2 5 6 7 8
axial skeleton tail region
weak weak
regionalweak expression: see section 6 7 8 9 0
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50449
Entity Detected:Gli3, GLI-Kruppel family member GLI3 ( MGI:95729)
Sequence:sense strand is shown

>T50449
TTGCTAGATTTCAGCCTGTCCGTGGCACCAAATGAGTTAGCTGGCAACACAGTGAATGGCATGCAAACCC
AAGATCAAATGGGACAGGGATACATTGCCCATCAGCTACTCAGTGGCAGCATGCAACACCAGGGGCCCAG
CCGCCCTGGTCAACAGGTACTAGGGCAGGTTGGTGCTACCTCACATATCAACATCTATCAAGGGACAGAG
AGCTGCCTACCAGGGACTCAGGACAACAGCAGCCAGCCATCAAGCATGGCAGCTATCAGGGGCTACCAGC
CCTGTGCCAGCTATGGGGGTAACAGGCGTCAGGCAATGCCAAGGGGCAACCTCACTCTGCAACAAGGACA
GCTCAGTGACATGAGTCAGAGCAGCAGGGTGAACAGCATCAAAATGGAGGCACAAGGTCAGTCCCAGCAG
CTCTGCTCTACCGTGCAGAATTATTCCGGTCAGTTCTATGACCAAACCATGGGCTTCAGTCAGCAAGACA
GGAAAGCTGGCTCGTTCTCCCTCTCAGATGCCAACTGCCTGCTCCAAGGGACATGCACTGAAAACTCTGA
GTTACTCTCCCCAGGTGCTAACCAGGTAACAAGCACAGTTGACAGCTTTGAGAGTCATGACCTAGAAGGT
GTGCAGATTGATTTTGATGCCATCATAGATGATGGGGACCATACCAGCCTAATGTCAGGGGCCTTGAGCC
CAAGTATTATTCAGAACCTTTCCCACAGCTCCTCCCGTCTCACCACTCCGCGGGCATCCCTCCCATTCCC
AATCCCTATCCATGGGCACCACCAACATGGCTATCGGGGATATGAGTTCTTTGCTGACCTCCCTTGCAGA
AGAAAGCAAGTTCCTTGCAGTTATGCAGTAGGCGGTAGGCAAGGAGGACCACAAACACAAAGACTGAAAT
GACTTGGGATTTTTTTTTCTTTTTTAAGTTCTGTGTGTATTTTAGCAATCTCATCTCACCTGATTGGGAT
GTGTCTCAAG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TTGCTAGATTTCA; Reverse Primer - name:unspecified, sequence:CTTGAGACACATCCC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_018378 same experiment
 EMAGE:21708 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS