Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21709

Irx1 Iroquois related homeobox 1 (Drosophila) ( MGI:1197515)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21709 EMAGE:21709 EMAGE:21709 EMAGE:21709 EMAGE:21709
"Pseudo-wholemount" of euxassay_019640. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019640_01 euxassay_019640_02 euxassay_019640_03 euxassay_019640_04
EMAGE:21709 EMAGE:21709 EMAGE:21709 EMAGE:21709 EMAGE:21709
euxassay_019640_05 euxassay_019640_06 euxassay_019640_07 euxassay_019640_08 euxassay_019640_09
EMAGE:21709 EMAGE:21709 EMAGE:21709 EMAGE:21709 EMAGE:21709
euxassay_019640_10 euxassay_019640_11 euxassay_019640_12 euxassay_019640_13 euxassay_019640_14
EMAGE:21709 EMAGE:21709 EMAGE:21709 EMAGE:21709 EMAGE:21709
euxassay_019640_15 euxassay_019640_16 euxassay_019640_17 euxassay_019640_18 euxassay_019640_19
EMAGE:21709 EMAGE:21709 EMAGE:21709 EMAGE:21709 EMAGE:21709
euxassay_019640_20 euxassay_019640_21 euxassay_019640_22 euxassay_019640_23 euxassay_019640_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21709Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21709_wholemount_strong.wlz
21709_wholemount_moderate.wlz
21709_wholemount_weak.wlz
21709_wholemount_possible.wlz
21709_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21709_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 2 4
forelimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 1 2 3 4
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 6 4
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 6 4
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 6 4
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 6 4
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 6 4
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 6 7 3 4
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 6 4
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 6 7 8 3 4
hindlimb digit 5 metatarsal
strong strong
regionalstrong expression: see section 6 7 4
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 6 7 8 3 4
submandibular gland primordium
strong strong
regionalstrong expression: see section 7 8 9 0 8 9 0 1
pancreas
strong strong
regionalstrong expression: see section 8 moderate expression: see section 7 9
epidermis
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4
vibrissa
moderate moderate
regionalmoderate expression: see section 5 6 7 weak expression: see section 4 8 3 4
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 3 4 5 6 7 8 9 0 1 moderate expression: see section 9 0 1 2
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 3 4
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 3 4 5 6 7 8 9 moderate expression: see section 8 9 0 1
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 5 0 1 2 moderate expression: see section 6 7 8
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 4 5 7 8 9 moderate expression: see section 1 0
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 3 5 3 4 5 7 8 9 0 1 2 3 moderate expression: see section 4 6 7 8 0 1 2 6 4
pons mantle layer
strong strong
regionalstrong expression: see section 3 4 5 7 8 9 moderate expression: see section 7 8 0 1 2 6 0
pons ventricular layer
strong strong
regionalstrong expression: see section 3
midbrain mantle layer
strong strong
regionalstrong expression: see section 3 4 5 6 7 8 9 0 moderate expression: see section 9 0 1 2
midbrain ventricular layer
strong strong
regionalstrong expression: see section 3 4 moderate expression: see section 1 2
ventral grey horn
strong strong
single cellstrong expression: see section 0 1 2 3 4 5 6 7
saccule
strong strong
regionalstrong expression: see section 5 6 7 8 7 8 9 0 1 2 moderate expression: see section 9 0 3
extrinsic ocular muscle
strong strong
regionalstrong expression: see section 5 6 moderate expression: see section 3 4 7 2 3 4 weak expression: see section 1
heart ventricle
weak weak
regionalweak expression: see section 1 2 3 4 5 6
lower jaw incisor
strong strong
regionalstrong expression: see section 3 6 7 8 moderate expression: see section 2
lower jaw molar
strong strong
regionalstrong expression: see section 1 moderate expression: see section 8
upper jaw incisor
strong strong
regionalstrong expression: see section 3 4 6 7 8 moderate expression: see section 2
upper jaw molar
strong strong
regionalstrong expression: see section 7 2 3
metanephros
strong strong
regionalstrong expression: see section 9 0 1 9 0 1
urethra of male
weak weak
regionalweak expression: see section 5 6
larynx
strong strong
regionalstrong expression: see section 3 moderate expression: see section 4
lung
strong strong
regionalstrong expression: see section 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4
trachea
moderate moderate
regionalmoderate expression: see section 3 4
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55088
Entity Detected:Irx1, Iroquois related homeobox 1 (Drosophila) ( MGI:1197515)
Sequence:sense strand is shown

>T55088
ACCTCGGTGCTAGGCATGTATGCCGCGGCGGGACCGTACGCGGGCGCACCCAACTACAGCGCCTTCTTGC
CCTATGCCGCGGACCTCAGCCTCTTCTCGCAGATGGGCTCTCAGTATGAACTGAAGGACAACCCCGGGGT
GCACCCAGCGACCTTCGCAGCCCACACAACGCCTGCTTATTATCCCTATGGTCAGTTTCAATACGGGGAT
CCCGGACGGCCCAAGAACGCCACGCGGGAGAGCACCAGCACGCTGAAAGCCTGGCTCAACGAACACCGCA
AGAACCCGTACCCCACCAAAGGAGAGAAGATTATGCTGGCCATTATCACCAAGATGACCCTCACACAGGT
CTCCACCTGGTTCGCCAATGCGCGCCGGCGCCTCAAGAAGGAGAACAAGGTGACTTGGGGGGCGCGCACG
AAGGACCAGGAAGACGGCGCCCTCTTTGGCAGCGACACCGAGGGCGACCCCGAGAAGGCCGAGGACGACG
AGGAGATCGACCTGGAGAGCATTGACATCGATCAGATCGACGAGCGTGATGGCGACCAGAGCAACGAAGA
CGAAGAGGACAAGGCGGAGGCTCCTAGGGCGCGCGTACGCCCTCCCGCCTCAGCTCGGGACCAGAGCTCC
CCATTGTCGGCTGCTGAGACACTCAAGTCTCAAGATTCGCCCTTGGGCCTGGTTAAGGAGGTCTCAGAGC
CCGGCAGCACACGCCTGCTGAGTCCTGGCGCCGCGGCGGTCGGCCTGCAGGGCGCGCCGCACAGCAAGCC
CAAGATCTGGTCTCTGGCTGAGACAGCCACTAGCCCCGATGGTGCGCCTAAGGCGTCTCCACCGCCACCC
TCAAGCCACGCCAGCGCACACGGGCCGCCCAGCGGCTCACCCCTGCAACACCCGGCCTTTCTACCCAGCC
ACGGACTGTACACCTGTCACATAGGCAAGTTTTCCAACTGGACCAACGGCGCGTTCCTAGCACAGGGCT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:unspecified; Reverse Primer - name:unspecified, sequence:unspecified. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_019640 same experiment
 EMAGE:29263 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS