Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21749

Tbx18 T-box18 ( MGI:1923615)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21749 EMAGE:21749 EMAGE:21749 EMAGE:21749 EMAGE:21749
euxassay_000121_01 euxassay_000121_02 euxassay_000121_03 euxassay_000121_04 euxassay_000121_05
EMAGE:21749 EMAGE:21749 EMAGE:21749 EMAGE:21749 EMAGE:21749
euxassay_000121_06 euxassay_000121_07 euxassay_000121_08 euxassay_000121_09 euxassay_000121_10
EMAGE:21749 EMAGE:21749 EMAGE:21749 EMAGE:21749 EMAGE:21749
euxassay_000121_11 euxassay_000121_12 euxassay_000121_13 euxassay_000121_14 euxassay_000121_15
EMAGE:21749 EMAGE:21749 EMAGE:21749 EMAGE:21749 EMAGE:21749
euxassay_000121_16 euxassay_000121_17 euxassay_000121_18 euxassay_000121_19 euxassay_000121_20
EMAGE:21749 EMAGE:21749 EMAGE:21749
euxassay_000121_21 euxassay_000121_22 euxassay_000121_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21749Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21749_wholemount_strong.wlz
21749_wholemount_moderate.wlz
21749_wholemount_weak.wlz
21749_wholemount_possible.wlz
21749_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21749_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hand mesenchyme
strong strong
regionalstrong expression: see section 0 1 2 3
vibrissa
moderate moderate
regionalmoderate expression: see section 4 5 6 7 8 9 0 1 2 3
vibrissa dermal component
moderate moderate
regionalmoderate expression: see section 4 5 6 7
vibrissa epidermal component
moderate moderate
regionalmoderate expression: see section 7 8
inner ear
strong strong
regionalstrong expression: see section 1
labyrinth
strong strong
regionalstrong expression: see section 2 3 4 5 6 7 8 9 8 9 0 1 2 3
otic capsule
strong strong
regionalstrong expression: see section 3 4 5 6 7 8 9 0 1 2 8 9 0 1 2 3
inner ear vestibular component
strong strong
regionalstrong expression: see section 3 4 5 6 7 9 0 1 2 3
inner canthus
strong strong
gradedstrong expression: see section 1 2
upper eyelid
strong strong
regionalstrong expression: see section 1 2
perioptic mesenchyme
strong strong
regionalstrong expression: see section 3
lower lip
moderate moderate
regionalmoderate expression: see section 7 8 9 0
upper lip
moderate moderate
regionalmoderate expression: see section 6 7
glans of male genital tubercle
moderate moderate
regionalmoderate expression: see section 0 1 2 5 weak expression: see section 6
urethra of male
strong strong
regionalstrong expression: see section 2 6
vault of skull
moderate moderate
regionalmoderate expression: see section 4
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1527
Entity Detected:Tbx18, T-box18 ( MGI:1923615)
Sequence:sense strand is shown

>T1527
TCCGCTCAGCAGTGGGGGCCAGCAGAGTTTCTTTGACTCCAGGACCCTAGGAAGTTTAACTCTGCCATCT
CCTCAAGTGTCTGCACATATGGTCTGATGAAGCCTTTAAGTTAAACGGCGTTGGAATCTAGTGGATCTTC
CTTATTTTTTTAAAGCAATATAGGGAAAATGTACACATAGTAGGAAAGGAAGGCCCAGTGAGTGTTTTTA
CTTTCTCATGGCAAGATTGTAATTATGGTACATATGTATGCTGTATATATACATAGCATGTAGTATACTG
AAGCCTTCTCTCTGCCTTGTCTATTCAGTTCCACAGAGTATTGGCGACATGGACTATGTTTATCCAGAAT
AATCAGACTCTAAAAGTAAAATGGTACACTTGAAAGTTGGTAAGGATGCTACCAAAGACTTTTCTAATGC
CCACGTGCCAAGTGATGGGGGTTTATTACAGCAGTGTCATACATACCTAACCAAAGATTTGTAACTTCAT
TTATCAGAAGAATGCTCTGAGCAGTCTGT
Notes:The probe template was PCR amplified from IMAGE:819918 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:819918 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000121 same experiment
 EMAGE:21747 same embryo
 EMAGE:21751 same embryo
 EMAGE:21750 same embryo
 EMAGE:21748 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS