Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21814

Dmgdh dimethylglycine dehydrogenase precursor ( MGI:1921379)
TS12 (7.75 dpc)
in situ hybridisation

Data Images
EMAGE:21814 EMAGE:21814 EMAGE:21814 EMAGE:21814
Lateral view Anterior View Distal View Posterior View

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21814Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21814_wholemount__moderate.wlz
21814_wholemount__weak.wlz
21814_wholemount__notDetected.wlz
21814_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21814_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
primitive streak
detected detected
regionalExpression is present in the crown region of the node.
embryo endoderm
weak weak
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1739527
Entity Detected:Dmgdh, dimethylglycine dehydrogenase precursor ( MGI:1921379)
Notes:The Dmgdh probe template used in this study by Tamplin et al, was PCR amplified from IMAGE:5100423 clone using the vector (pCMV-SPORT6) specific primers: pCMV-SPORT6 FWD ACAAAGATCCCAAGCTAGCAG and pCMV-SPORT6 REV TTGACCTCCATAGAAGACACC. T7 polymerase was used to generate antisense probe.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:ICR
Age:7.75 dpc
Theiler Stage:TS12
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:Owen J. Tamplin, Brian J. Cox, Janet Rossant.
Principal investigator:Janet Rossant, The Hospital for Sick Children Research Institute, TMDT at MaRS Room 13-305 101 College Street, Toronto, ON, Canada M5G1L7
Submitted by:Owen Tamplin, HHMI/Children's Hospital Boston, Zon Lab, Division of Hematology/Oncology 300 Longwood Avenue, Karp 8, Boston, MA, USA 02115
Experiment type:screen
References:[ doi:10.1016/j.ydbio.2011.10.002] [ PMID:22008794] Tamplin OJ, Cox BJ, Rossant J 2011 Integrated microarray and ChIP analysis identifies multiple Foxa2 dependent target genes in the notochord. Dev Biol (360)
Links:MGI:5291695 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE