EMAGE mouse gene expression spatial database

EMAGE:23820

1700007G11Rik RIKEN cDNA 1700007G11 gene ( MGI:1916571)
TS12 (8.0 dpc)
in situ hybridisation

Data Images


Posterior Ventral Detail View

Expression pattern clarity:

Expression Pattern Description

Text Annotation:

Structure

Level

Pattern

Notes

primitive streak

detected

Expression is present in the node.

Annotation Validation:

EMAGE Editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	MGI:2497120
Entity Detected:	1700007G11Rik, RIKEN cDNA 1700007G11 gene ( MGI:1916571)
Notes:	The 1700007G11Rik probe template used in this study by Tamplin et al, was PCR amplified from IMAGE clone 6399677 using the vector (pBS SK+) specific primers: pBS FWD GTTTTCCCAGTCACGACGTT and pBS REV TGTGGAATTGTGAGCGGATA. T3 polymerase was used to generate antisense probe.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	4% paraformaldehyde
Staining procedure:	alkaline phosphatase + BMpurple

General Information

Authors:	Owen J. Tamplin, Brian J. Cox, Janet Rossant.
Principal investigator:	Janet Rossant, The Hospital for Sick Children Research Institute, TMDT at MaRS Room 13-305 101 College Street, Toronto, ON, Canada M5G1L7
Submitted by:	Owen Tamplin, HHMI/Children's Hospital Boston, Zon Lab, Division of Hematology/Oncology 300 Longwood Avenue, Karp 8, Boston, MA, USA 02115
Experiment type:	screen
References:	[ doi:10.1016/j.ydbio.2011.10.002] [ PMID:22008794] Tamplin OJ, Cox BJ, Rossant J 2011 Integrated microarray and ChIP analysis identifies multiple Foxa2 dependent target genes in the notochord. Dev Biol (360)
Links:	MGI:5291803 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source