Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:23840

Cdo1 cysteine dioxygenase 1, cytosolic ( MGI:105925)
TS11 (7.75 dpc)
in situ hybridisation

Data Images
EMAGE:23840 EMAGE:23840
Anterior View Distal View

Expression pattern clarity: no stars
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
node
detected detected
regionalExpression is present in the crown region of the node.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3064035
Entity Detected:Cdo1, cysteine dioxygenase 1, cytosolic ( MGI:105925)
Notes:The Cdo1 probe template used in this study by Tamplin et al, was PCR amplified from NIA clone H3061E04 using the vector (pSPORT1) specific primers: pSPORT1 FWD GCTATTACGCCAGCTGGCGAAAGGGGGATGTG and pSPORT1 REV CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. SP6 polymerase was used to generate antisense probe.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:ICR
Age:7.75 dpc
Theiler Stage:TS11
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:Owen J. Tamplin, Brian J. Cox, Janet Rossant.
Principal investigator:Janet Rossant, The Hospital for Sick Children Research Institute, TMDT at MaRS Room 13-305 101 College Street, Toronto, ON, Canada M5G1L7
Submitted by:Owen Tamplin, HHMI/Children's Hospital Boston, Zon Lab, Division of Hematology/Oncology 300 Longwood Avenue, Karp 8, Boston, MA, USA 02115
Experiment type:screen
References:[ doi:10.1016/j.ydbio.2011.10.002] [ PMID:22008794] Tamplin OJ, Cox BJ, Rossant J 2011 Integrated microarray and ChIP analysis identifies multiple Foxa2 dependent target genes in the notochord. Dev Biol (360)
Links:MGI:5291813 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE