Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:240

Crabp1 cellular retinoic acid binding protein I ( MGI:88490)
TS15 (9.5)
in situ hybridisation

Data Images
EMAGE:240
Figure 4A of Dupe et al., 1999 [PMID:10529422] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Abbreviations used: B1, B2, pharyngeal (branchial) arches one and two; CS, caudal stream of cranial neural crest cells emanating from rhombomeres 6 and 7; SG, first spinal ganglion. See EMAGE:239 for a section taken through this embryo.
Expression Pattern Description
Spatial Annotation:
EMAGE:240Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
240_wholemount_strong_3D_1.wlz
240_wholemount_moderate_3D_1.wlz
240_wholemount_weak_3D_1.wlz
240_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:240_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
branchial arch
detected detected
single cellCRABPI is expressed in two broad subectodermal sheets of neural crest cells arising from rhombomeres 4, 6 & 7; they colonize the periphery of the 2nd, 3rd & 4th arches, respectively, enveloping negative mesenchymal cells derived from paraxial mesoderm.
2nd branchial arch
detected detected
single cellCRABPI is expressed in two broad subectodermal sheets of neural crest cells arising from rhombomeres 4, 6 & 7; they colonize the periphery of the 2nd, 3rd & 4th arches, respectively, enveloping negative mesenchymal cells derived from paraxial mesoderm
3rd branchial arch
detected detected
single cellCRABPI is expressed in two broad subectodermal sheets of neural crest cells arising from rhombomeres 4, 6 & 7; they colonize the periphery of the 2nd, 3rd & 4th arches, respectively, enveloping negative mesenchymal cells derived from paraxial mesoderm
rhombomere 04
strong strong
neural tube
detected detected
gradedExpression gradually decreases in r7 and more posterior regions of the neural tube
rhombomere 07
detected detected
gradedExpression gradually decreases in r7 and more posterior regions of the neural tube
rhombomere 06
strong strong
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:14729
Entity Detected:Crabp1, cellular retinoic acid binding protein I ( MGI:88490)
Sequence:sense strand is shown

>MGI:14729
CCAGCGTGCGACCGCTCCGCAGCAGAGGTGGGTGCCTGCCCCTGCCTTCGCGCCGCCGTACAGCCAACAC
CACTGCCACCATGCCCAACTTCGCCGGTACCTGGAAGATGCGCAGCAGCGAGAATTTCGACGAGCTCCTC
AAGGCGTTGGGTGTGAACGCCATGCTGAGGAAGGTGGCCGTGGCGGCTGCGTCTAAGCCGCACGTGGAGA
TCCGCCAAGACGGGGATCAGTTCTACATCAAGACATCCACTACTGTGCGCACCACGGAGATCAACTTCAA
GGTCGGAGAGGGCTTCGAGGAGGAGACAGTGGACGGACGCAAATGCAGGAGTTTACCCACGTGGGAGAAT
GAGAACAAGATTCACTGCACACAGACTCTTCTGGAGGGGGATGGCCCCAAAACTTACTGGACCCGAGAGC
TGGCCAACGATGAGCTCATCCTGACATTTGGCGCCGATGATGTGGTCTGCACGAGGATTTATGTCCGGGA
GTGAAAGGTGGCCAGCTTGTTCCTGCTTCATGACGATGCGAGTTCCCCTGAGGGGTATGCCGTGGCCCCA
CACTGCCAGTGGGTCTTTACTCCACACACCTCTCCCCCATGAATATTAGGCAACCCCATTTTCCCCATGA
CATTGTTGTAGTGTCCTCCCCTCAGGCTCTTGTTGCCTTGTGTACTGTGTACCCTTGTTTGGCATTTGCA
TGATGTACCAGTCATTAAACTGGTTGGCTGC
nt 1 - nt 731 of X15481.1
Notes:The probe used in this study by Dupe et al., 1999 [PMID:10529422] is indicated as being described by Dolle et al, 1990 [PMID:2556642] ie. as the "CRABP full length cDNA (Stoner & Gudas, 1989 [PMID:2538228] - see Fig1B in Stoner for sequence). The probe includes an additional poly(A) tail not included in the sequence link above.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Dupe et al., 1999 [PMID:10529422] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:10529422] Dupe V, Ghyselinck NB, Wendling O, Chambon P, Mark M 1999 Key roles of retinoic acid receptors alpha and beta in the patterning of the caudal hindbrain, pharyngeal arches and otocyst in the mouse. Development (126):5051-9
 [ doi:10.1038/342702a0] [ PMID:2556642] Dolle P, Ruberte E, Kastner P, Petkovich M, Stoner CM, Gudas LJ, Chambon P 1989 Differential expression of genes encoding alpha, beta and gamma retinoic acid receptors and CRABP in the developing limbs of the mouse. Nature (342):702-5
 [ PMID:2538228] Stoner CM, Gudas LJ 1989 Mouse cellular retinoic acid binding protein: cloning, complementary DNA sequence, and messenger RNA expression during the retinoic acid-induced differentiation of F9 wild type and RA-3-10 mutant teratocarcinoma cells. Cancer Res (49):1497-504
Links:MGI:1346588 same experiment
 EMAGE:239 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI