Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:258

Actc1 actin, alpha, cardiac muscle 1 ( MGI:87905)
TS20 (12.5 dpc)
in situ hybridisation

Data Images
EMAGE:258 EMAGE:258 EMAGE:258 EMAGE:258
Figure 9C of Moens et al., 1993 [PMID:8287798] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Figure 9A of Moens et al., 1993 [PMID:8287798] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Figure 9F of Moens et al., 1993 [PMID:8287798] . This is a high power image of Figure 9A. Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Figure 9H of Moens et al., 1993 [PMID:8287798] . This is a high power image of Figure 9C. Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
A and C are roughly corresponding bright and dark-field images. H and F are high power images of A and C. Abbreviations: A, atrium; C, compact layer; E, endocardial cushion; Ep, epicardium; LV, left ventricle; T, trabeculae.
Expression Pattern Description
Spatial Annotation:
EMAGE:258EMAGE:258Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
258_voxel_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:258_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
heart
detected detected
homogeneousAlpha-cardiac actin is expressed in both the trabeculae and the compact layer.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1276342
Entity Detected:Actc1, actin, alpha, cardiac muscle 1 ( MGI:87905)
Sequence:sense strand is shown

>MGI:1276342
AGGCGACTGACACCCAGTGCCTGCCACCAGCGCCAGCCCAGCTGAATCCAGCCGCCCCTAGCACGGTGAG
TCCCAGCCTTGCTCCCTGCAGGACCTTGTCAGCACTGTGCTTTTGTGCTCTTGGATCC
nt 662 - nt 789 of M59866.1
Notes:The probe used in this study by Moens et al., 1993 [PMID:8287798] is indicated as being described by Sassoon et al., 1988 [PMID:3075543] ie. as a BamHI genomic fragment which includes the first non-coding exon (see Fig 1B therein). NB. the target sequence for this probe is the reverse and complement of the sequence in the link above (the sequence in M59866 is the reverse strand).
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Age:12.5 dpc
Theiler Stage:TS20
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:10% formalin
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Moens et al, 1993 [PMID:8287798] . Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:8287798] Moens CB, Stanton BR, Parada LF, Rossant J 1993 Defects in heart and lung development in compound heterozygotes for two different targeted mutations at the N-myc locus. Development (119):485-99
 [ PMID:3075543] Sassoon DA, Garner I, Buckingham M 1988 Transcripts of alpha-cardiac and alpha-skeletal actins are early markers for myogenesis in the mouse embryo. Development (104):155-64
Links:MGI:1276360 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI