Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29161

Cdc42ep3 ( MGI:2384718)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:29161 EMAGE:29161 EMAGE:29161 EMAGE:29161 EMAGE:29161
euxassay_000724_01 euxassay_000724_02 euxassay_000724_03 euxassay_000724_04 euxassay_000724_05
EMAGE:29161 EMAGE:29161 EMAGE:29161 EMAGE:29161 EMAGE:29161
euxassay_000724_06 euxassay_000724_07 euxassay_000724_08 euxassay_000724_09 euxassay_000724_10
EMAGE:29161 EMAGE:29161 EMAGE:29161 EMAGE:29161 EMAGE:29161
euxassay_000724_11 euxassay_000724_12 euxassay_000724_13 euxassay_000724_14 euxassay_000724_15
EMAGE:29161 EMAGE:29161 EMAGE:29161 EMAGE:29161 EMAGE:29161
euxassay_000724_16 euxassay_000724_17 euxassay_000724_18 euxassay_000724_19 euxassay_000724_20
EMAGE:29161 EMAGE:29161 EMAGE:29161 EMAGE:29161
euxassay_000724_21 euxassay_000724_22 euxassay_000724_23 euxassay_000724_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T945
Entity Detected:Cdc42ep3, ( MGI:2384718)
Sequence:sense strand is shown

>T945
TCCTCGAGNCTGTTGGCCTACTGGAGTGTCGCGGGCGCTTCCACTGCCGCTGGGAGCACAGCAGCGGGAC
GCTCACCGACAACCCAGTTCCGCAGCGGCTGCCTCCCGGGAGACGCCGCGCGCAGTCCCGGAGCAGATTC
TGCGGTGAACCGTTGCCGCCCCTCTGGTTCTGCGCGCACCAGCGAGGACTGTTGCGCCCTCGGGAGGCGA
CCCGGGCCGACGCCCGGCCCTCCGGGCAGAAGCTAGGAGCCTTAGAGACTGCTGGTTTCTCCGAGCTGTG
GAAGGGACTCGATAATGTAACTGGCTCTCCGGAAAGACCCGCGTGGCCCTGCGCTGAGCAAGATCTCCCA
GACCCTGTCTCGTTTTTAGAGCCCCTT
Notes:The probe template was PCR amplified from IMAGE:1970072 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1970072 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000724 same experiment
 EMAGE:31804 same embryo
 EMAGE:30825 same embryo
 EMAGE:29183 same embryo
 EMAGE:29352 same embryo
 EMAGE:31799 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS