EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29219

Coq7 ( MGI:107207)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_000717_01	euxassay_000717_02	euxassay_000717_03	euxassay_000717_04	euxassay_000717_05

euxassay_000717_06	euxassay_000717_07	euxassay_000717_08	euxassay_000717_09	euxassay_000717_10

euxassay_000717_11	euxassay_000717_12	euxassay_000717_13	euxassay_000717_14	euxassay_000717_15

euxassay_000717_16	euxassay_000717_17	euxassay_000717_18	euxassay_000717_19	euxassay_000717_20

euxassay_000717_21	euxassay_000717_22	euxassay_000717_23	euxassay_000717_24

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T932
Entity Detected:	Coq7, ( MGI:107207)
Sequence:	sense strand is shown >T932 TCCTCGAGNCTGTTGGCCTACTGGGAGTCGAGAGCACGATTGGCGGGGCGTTTGGACCATAGCTGCATTG TCCGCAGCGATGAGCGCCGCCGGAGCCATAGCGGCTGCTTCCGTGGGACGCCTGCGCACTGGTGTCCGGA GGCCCTTCTCAGAGTATGGAAGAGGCCTCATCATCAGGTGTCACAGTTCGGGGATGACCTTAGACAATAT TAACCGGGCAGCCGTGGATCGAATAATTCGGGTGGATCACGCTGGTGAATATGGAGCAAACCGCATCTAT GCAGGGCAAATGGCCGTGCTCGGTCGGACCAGTGTTGGCCCTGTCATTCAGAAAATGTGGGATCAAGAGA AGAACCATTTGAAAAAGTTTAACGAGTTGATGATTGCATTCAGGGTCCGACCTACGGTTTTGATGCCCTT GTGGAACGTGGCAGGCTTTGCCCTGGGGGCAGGAACTGCCTTGCTGGGGAAGGAAGGAGCAATGGCCTGC ACCGTGGCGGTAGAAGAGTCTATCGCTAATCACTACAACAACCAGATCCGCATGCTGATGG
Notes:	The probe template was PCR amplified from IMAGE:1925174 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1925174 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_000717 same experiment
	EMAGE:29162 same embryo
	EMAGE:29163 same embryo
	EMAGE:29178 same embryo
	EMAGE:29159 same embryo
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source