EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29631

Lamp2 lysosomal-associated membrane protein 2 ( MGI:96748)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_000444_01	euxassay_000444_02	euxassay_000444_03	euxassay_000444_04	euxassay_000444_05

euxassay_000444_06	euxassay_000444_07	euxassay_000444_08	euxassay_000444_09	euxassay_000444_10

euxassay_000444_11	euxassay_000444_12	euxassay_000444_13	euxassay_000444_14	euxassay_000444_15

euxassay_000444_16	euxassay_000444_17	euxassay_000444_18	euxassay_000444_19	euxassay_000444_20

euxassay_000444_21

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T1458
Entity Detected:	Lamp2, lysosomal-associated membrane protein 2 ( MGI:96748)
Sequence:	sense strand is shown >T1458 CCTCGAGCCTGTTGGCCTACTGGCTTGTTGGCCTACTGGGTCTTATGACTCCAGCTGAAGCGGCGAGTCC AGGCTTTTGCGGTGCCTGGGTGCCTCGGTCGGTGGTCTCTCGTGCTTTCGCTTCCGCAGGGCTGCGAGGG GATTCGTTGGAATTGTCGGTCCGGTGGTCGCCTGGCCTGAGGGATCACGATGTGCCTCTCTCCGGTTAAA GGCGCAAAGCTCATCCTGATCTTTCTGTTCCTAGGAGCCGTTCAGTCCAATGCATTGATAGTTAATTTGA CAGATTCAAAGGGTACTTGCCTTTATGCAGAATGGGAGATGAATTTCACAATAACATATGAAACTACAAA CCAAACCAATAAAACTATAACCATTGCAGTACCTGACAAGGCGACACACGATGGAAGCAGTTGTGGGGAT GACCGGAATAGTGCCAAAATAATGATACAATTTGGATTCGCTGTCTCTTGGGCTGTGAATTTTACCAAGG AAGCATCTCATTATTCAATTCATGACATCGTGCTTTCCTACAACACTAGTGATAGCACAGTATTTCCTGG TGCTGTAGCTAAAGGA
Notes:	The probe template was PCR amplified from IMAGE:2536619 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2536619 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_000444 same experiment
	EMAGE:30060 same embryo
	EMAGE:31680 same embryo
	EMAGE:29632 same embryo
	EMAGE:29699 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source