Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29771

Spsb1 splA/ryanodine receptor domain and SOCS box containing 1 ( MGI:1921896)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:29771 EMAGE:29771 EMAGE:29771 EMAGE:29771 EMAGE:29771
euxassay_005628_01 euxassay_005628_02 euxassay_005628_03 euxassay_005628_04 euxassay_005628_05
EMAGE:29771 EMAGE:29771 EMAGE:29771 EMAGE:29771 EMAGE:29771
euxassay_005628_06 euxassay_005628_07 euxassay_005628_08 euxassay_005628_09 euxassay_005628_10
EMAGE:29771 EMAGE:29771 EMAGE:29771 EMAGE:29771 EMAGE:29771
euxassay_005628_11 euxassay_005628_12 euxassay_005628_13 euxassay_005628_14 euxassay_005628_15
EMAGE:29771 EMAGE:29771 EMAGE:29771 EMAGE:29771 EMAGE:29771
euxassay_005628_16 euxassay_005628_17 euxassay_005628_18 euxassay_005628_19 euxassay_005628_20
EMAGE:29771 EMAGE:29771
euxassay_005628_21 euxassay_005628_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3789
Entity Detected:Spsb1, splA/ryanodine receptor domain and SOCS box containing 1 ( MGI:1921896)
Sequence:sense strand is shown

>T3789
TGGCTCGAGCCAGATTCGGACGAGGCGGACTTGATCCTGAGCCCCTGCCACTCATGGACCTGTGCCGGCG
TTCGGTGCGCCTAGCGCTGGGAAAGGAGCGCCTGGGTGCCATCCCCGCTCTGCCGCTACCTGCCTCCCTC
AAAGCCTACCTCCTCTACCAGTGATCCAAATCCCAGGACCGCCATACGACAGCCACCTGGTGCCAAGTCA
CTGAGCCCGTTGGGGTCCGCCGACCCCTGCGCCTGGGATGGATGCCCACCCTCAGCCATGGGCAGACGTG
CCCCCTCATCCTACCGGCTGCCTCTGCTGGGGGAACCTATGCCAACGGACTTCTCCCTTCCCAACACTGG
CTGAAGCAGCAGCACCCAGGCCCTTCCCTGAACCAGATGCAGAGAATAAACTATGAGAACCTCTCTCAGG
CGCCTTCTGCTCTCAGGTGGAGTGGGCTGCCCCCCACTCTCTGCAGAGAGAGGCTACACCCACCTGGGGG
GTCCTGGGAGGTAAGACTAGTAGGAGGTGCCAGGGCTGAGTCCAAAAGCAGGAATGGCCAGGACCAGG
Notes:The probe template was PCR amplified from IMAGE:391880 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:391880 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_005628 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS