EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30063

Cops7a COP9 (constitutive photomorphogenic) homolog, subunit 7a (Arabidopsis thaliana) ( MGI:1349400)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_002749_01	euxassay_002749_02	euxassay_002749_03	euxassay_002749_04	euxassay_002749_05

euxassay_002749_06	euxassay_002749_07	euxassay_002749_08	euxassay_002749_09	euxassay_002749_10

euxassay_002749_11	euxassay_002749_12	euxassay_002749_13	euxassay_002749_14	euxassay_002749_15

euxassay_002749_16	euxassay_002749_17	euxassay_002749_18	euxassay_002749_19	euxassay_002749_20

euxassay_002749_21	euxassay_002749_22	euxassay_002749_23

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T1005
Entity Detected:	Cops7a, COP9 (constitutive photomorphogenic) homolog, subunit 7a (Arabidopsis thaliana) ( MGI:1349400)
Sequence:	sense strand is shown >T1005 TCCTCNAGNCTGTTGGCCTACTGGTAGAGCGGCCCTGCGGGGAGGTGGCAGGAAAGGCTTGGGAGCCGCT GCCGGAGGTGACGGAGCGGCCGCCCCGCCCCGTGCGCTGGGAGACGAGGCTTCCAGCTCCAGAAATCTTG AGGCCAGAGCCCCGCACCTCGGCGCAGCCATGAGTGCGGAGGTGAAGGTGACAGGGCAGAACCAAGAGCA GTTTCTGCTCCTTGCCAAGTCGGCTAAGGGGGCGGCACTGGCCACACTCATCCACCAGGTGCTGGAGGCC CCTGGTGTCTACGTGTTTGGGGAACTGCTGGATATGCCTAATGTTAGAGAGCTGGCAGAAAGCGACTTTG CCTCCACCTTCCGGCTGCTCACAGTGTTTGCCTATGGGACCTATGCGGACTACTTAGCTGAAGCCAGGAA TCTCCCCCCACTGACTGACGCACAGAAGAATAAGCTTCGACATCTGTCAGTTGTCACTCTGGCTGCCAAA GTCAAGTGTATCCCATATGCAGTGTTGCTGGAGGCCCTTGCCCTTCGAAACGTGCGCCA
Notes:	The probe template was PCR amplified from IMAGE:2064735 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2064735 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_002749 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source