Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30182

Ndufa3 ( MGI:1913341)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30182 EMAGE:30182 EMAGE:30182 EMAGE:30182 EMAGE:30182
euxassay_012037_01 euxassay_012037_02 euxassay_012037_03 euxassay_012037_04 euxassay_012037_05
EMAGE:30182 EMAGE:30182 EMAGE:30182 EMAGE:30182 EMAGE:30182
euxassay_012037_06 euxassay_012037_07 euxassay_012037_08 euxassay_012037_09 euxassay_012037_10
EMAGE:30182 EMAGE:30182 EMAGE:30182 EMAGE:30182 EMAGE:30182
euxassay_012037_11 euxassay_012037_12 euxassay_012037_13 euxassay_012037_14 euxassay_012037_15
EMAGE:30182 EMAGE:30182 EMAGE:30182 EMAGE:30182 EMAGE:30182
euxassay_012037_16 euxassay_012037_17 euxassay_012037_18 euxassay_012037_19 euxassay_012037_20
EMAGE:30182 EMAGE:30182 EMAGE:30182 EMAGE:30182
euxassay_012037_21 euxassay_012037_22 euxassay_012037_23 euxassay_012037_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2944
Entity Detected:Ndufa3, ( MGI:1913341)
Sequence:sense strand is shown

>T2944
TGGCCTCGAGCCAGATTCGGCACGAGGGAATCTCTGCCTTCCTCAAGAATGCCTGGGCGAAGGAGCCGGT
GCTGGTGGTGTCCTTCTCTGTCTGGGGCCTCGCTATAATTATGCCCATGATTAGCCCCTACACCAAGTAT
GCTAGCATGATCAACAAGGCCACACCCTACAACTACCCAGTGCCTGTGAGAGATGACGGGAACATGCCTG
ATGTGCCCAGCCACCCTCAGGATCCTCTGGGTCCAAGCTTGGACTGGCTGAAGAACCTGTGAATGCCTCT
GCTGACGGAAGAGGCCCCTTCCCTGTTGCTCTCCAATAAAAATGTGAAAACTAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1531958 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1531958 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012037 same experiment
 EMAGE:30180 same embryo
 EMAGE:31170 same embryo
 EMAGE:30178 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS