Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30183

Zfp365 zinc finger protein 365 ( MGI:2143676)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30183 EMAGE:30183 EMAGE:30183 EMAGE:30183 EMAGE:30183
euxassay_014219_01 euxassay_014219_02 euxassay_014219_03 euxassay_014219_04 euxassay_014219_05
EMAGE:30183 EMAGE:30183 EMAGE:30183 EMAGE:30183 EMAGE:30183
euxassay_014219_06 euxassay_014219_07 euxassay_014219_08 euxassay_014219_09 euxassay_014219_10
EMAGE:30183 EMAGE:30183 EMAGE:30183 EMAGE:30183 EMAGE:30183
euxassay_014219_11 euxassay_014219_12 euxassay_014219_13 euxassay_014219_14 euxassay_014219_15
EMAGE:30183 EMAGE:30183 EMAGE:30183 EMAGE:30183 EMAGE:30183
euxassay_014219_16 euxassay_014219_17 euxassay_014219_18 euxassay_014219_19 euxassay_014219_20
EMAGE:30183 EMAGE:30183 EMAGE:30183 EMAGE:30183
euxassay_014219_21 euxassay_014219_22 euxassay_014219_23 euxassay_014219_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39483
Entity Detected:Zfp365, zinc finger protein 365 ( MGI:2143676)
Sequence:sense strand is shown

>T39483
GAGGTACGCACTTACCTGCTCTTTTTTGACCTCCATTCCAAGCAGAATTGGTAGACACTTTTTTACTTGT
AAAAGAACAAAGTCAGAAATATCTGAGTCGCAGCCTTAGTTTTCACTAGGCCAGAAGGTACCCAGATTTG
AAGGCTTTCAAGTTGATATTCTAAGTGTTATCATTTCAAGAAAGCAAGATTCAACCATGTGCATATATAC
CCTCAGCCTTCCTTACAGCGGAGGGAAACACTCTTCCACAGCGCTCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 160507. Forward Primer - name:160507_F_cDNA_Mm.342534, sequence:GAGGTACGCACTTACCTGCTCT; Reverse Primer - name:160507_N_SP6_cDNA_Mm.342534, sequence:GTGAGCGCTGTGGAAGAGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_014219 same experiment
 EMAGE:30362 same embryo
 EMAGE:30375 same embryo
 EMAGE:31474 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS