EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30240

Cdc20 cell division cycle 20 homolog (S. cerevisiae) ( MGI:1859866)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_005724_01	euxassay_005724_02	euxassay_005724_03	euxassay_005724_04	euxassay_005724_05

euxassay_005724_06	euxassay_005724_07	euxassay_005724_08	euxassay_005724_09	euxassay_005724_10

euxassay_005724_11	euxassay_005724_12	euxassay_005724_13	euxassay_005724_14	euxassay_005724_15

euxassay_005724_16	euxassay_005724_17	euxassay_005724_18	euxassay_005724_19	euxassay_005724_20

euxassay_005724_21	euxassay_005724_22	euxassay_005724_23	euxassay_005724_24

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T3864
Entity Detected:	Cdc20, cell division cycle 20 homolog (S. cerevisiae) ( MGI:1859866)
Sequence:	sense strand is shown >T3864 TGGCCTCGAGCCAGATTCGGACGAGGCATCANAAAGCCTGGTCTCTCAACCTGAACGGTTTTGATGTGGA GGAAGCCAAGATCCTCAGGCTCAGCGGCAAACCTCAGAATGCCCCAGAAGGCTACCAGAACAGACTGAAA GTACTGTACAGTCAGAAAGCCACGCCTGGCTCCAGCAGGAAGACTTGCAGATACATCCCTTCTCTGCCAG ACAGGATCCTTGATGCCCCCGAAATCCGGAATGACTACTACCTGAATCTTGTAGATTGGAGCTCTGGAAA TGTATTGGCTGTGGCACTGGACAACAGTGTGTACTTATGGAACGCTGGTTCTGGTGACATCCTGCAGTTG TTGCAAATGGAGCAGCCTGGAGACTACATATCCTCGGTGGCCTGGATCAAGGAGGGCAACTACCTAGCTG TAGGCACCAGCAATGCTGAGGTCCAGCTCTGGGATGTGCAGCAGCAGAAACGACTTCGAAACATGACCAG TCACTCCGCTCGAGTAAGCTCCCTCAGTTGGAACAGCTATATCCTATCCAGTGGTTCACGGTCTGGCCAC
Notes:	The probe template was PCR amplified from IMAGE:425838 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:425838 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_005724 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source