Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30260

Neurl1a neuralized homolog 1A (Drosophila) ( MGI:1334263)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30260 EMAGE:30260 EMAGE:30260 EMAGE:30260 EMAGE:30260
euxassay_000484_18 euxassay_000484_01 euxassay_000484_02 euxassay_000484_03 euxassay_000484_04
EMAGE:30260 EMAGE:30260 EMAGE:30260 EMAGE:30260 EMAGE:30260
euxassay_000484_05 euxassay_000484_06 euxassay_000484_07 euxassay_000484_08 euxassay_000484_09
EMAGE:30260 EMAGE:30260 EMAGE:30260 EMAGE:30260 EMAGE:30260
euxassay_000484_10 euxassay_000484_11 euxassay_000484_12 euxassay_000484_13 euxassay_000484_14
EMAGE:30260 EMAGE:30260 EMAGE:30260 EMAGE:30260 EMAGE:30260
euxassay_000484_15 euxassay_000484_16 euxassay_000484_17 euxassay_000484_19 euxassay_000484_20
EMAGE:30260 EMAGE:30260 EMAGE:30260 EMAGE:30260
euxassay_000484_21 euxassay_000484_22 euxassay_000484_23 euxassay_000484_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2308
Entity Detected:Neurl1a, neuralized homolog 1A (Drosophila) ( MGI:1334263)
Sequence:sense strand is shown

>T2308
TGGCCTCGAGCCAGATTCGTCGACATGATGCCTTCAGGCTGGAGCTGGTAAGTTGCCCCATCTAGCTGGG
GCTTATCCTAGAGATGGAGCAAGGTCCTAGTACAGAGCTGTGTGGCTGGAGTTGGGAAAAGAAGCCATTG
TCCATTCTGCTAGTTCAGAGGTAGCACTGCCTCCCTTGTGAACTGGGCCACTGTGTTTGTGAATAAAGGT
GATTTCGTACCAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1138681 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1138681 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000484 same experiment
 EMAGE:30261 same embryo
 EMAGE:30299 same embryo
 EMAGE:30298 same embryo
 EMAGE:30287 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS