EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30365

Dcun1d3 DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) ( MGI:2679003)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_016427_01	euxassay_016427_02	euxassay_016427_03	euxassay_016427_04	euxassay_016427_05

euxassay_016427_06	euxassay_016427_07	euxassay_016427_08	euxassay_016427_09	euxassay_016427_10

euxassay_016427_11	euxassay_016427_12	euxassay_016427_13	euxassay_016427_14	euxassay_016427_15

euxassay_016427_16	euxassay_016427_17	euxassay_016427_18	euxassay_016427_19	euxassay_016427_20

euxassay_016427_21	euxassay_016427_22	euxassay_016427_23

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T63138
Entity Detected:	Dcun1d3, DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) ( MGI:2679003)
Sequence:	sense strand is shown >T63138 AAGGAAAAGAGAAGTGGAAGGGAGAGGTACACTCAGCTCAGGGCAAGAGGGCTTGTGTCCAGAAGAGCAG ACTTAGCCGCTCTGTTCCAGGAGCAGCACTGAGGATCTGCCTGCTGCCCTGCAGCCAAATGAGGAATTGG ACCTTTCTGGAAATTACTGAAGATCCGGATATTTTCTACTTTACACCTTTCTCTGCCTTGTATTTGAAAG GGCTCTAAAATGCTGTATCATGTTTTAGGCACTTTCTTCATTTTTTTTTTTTTTTGTTATTTTGGTTATT TCTTTTTTGGGGGTGGGAAATCCCCCAAAATATTTGAACCTGGCTACATGTTGTGTACCTTTTTTTGAAG CCTTCAGATAGAATAAGCCTGCCATTTCTTGCACAACTTGATAGGATTTGTTTTGTGGGGGAGGGGAGGG TGTAGCCCGGGTTGGGAGTGGGTTGTTAGGTTGAATTAACATTACAAAATGATGCAGTGCCAGACCTCAG TTTTGCATATTATTTTTCAGGGCAGGTCTGTACTGTGTGTAGTGCTGTTTACATGGTTGAATTTAGGTTG TAATAATTATTTTAAAAGATTTACACAGATATGAATATAGCAGTGTTAACTGTTAGCCACAT
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 142665. Forward Primer - name:142665_F_cDNA_BC030335, sequence:AAGGAAAAGAGAAGTGGAAGGG; Reverse Primer - name:142665_N_SP6_cDNA_BC030335, sequence:ATGTGGCTAACAGTTAACACTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_016427 same experiment
	EMAGE:31342 same embryo
	EMAGE:30348 same embryo
	EMAGE:30337 same embryo
	EMAGE:30357 same embryo
	EMAGE:30356 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source