EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30566

Serpinb2 serine (or cysteine) peptidase inhibitor, clade B, member 2 ( MGI:97609)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_001970_01	euxassay_001970_02	euxassay_001970_03	euxassay_001970_04	euxassay_001970_05

euxassay_001970_06	euxassay_001970_07	euxassay_001970_08	euxassay_001970_09	euxassay_001970_10

euxassay_001970_11	euxassay_001970_12	euxassay_001970_13	euxassay_001970_14	euxassay_001970_15

euxassay_001970_16	euxassay_001970_17	euxassay_001970_18	euxassay_001970_19	euxassay_001970_20

euxassay_001970_21	euxassay_001970_22	euxassay_001970_23

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T4012
Entity Detected:	Serpinb2, serine (or cysteine) peptidase inhibitor, clade B, member 2 ( MGI:97609)
Sequence:	sense strand is shown >T4012 GGCCTCGAGCCAGATTCGGCACGAGGGGAATGTCTGAGAGGAATGACCTTTTTCTTTCTGAGGTGTTCCA TCAAGCCAGCGTGGATGTCACCGAGGAGGGCACTGTGGCAGCTGGTGGGACTGGGGCAGTTATGACAGGA AGAACTGGCCATGGTGGCCCACAGTTTGTGGCCGATCATCCCTTTCTTTTCTTTATCATGGACAAAATTA CCCACACGATACTATTTGTTGGTAGATTCTCCTCACCCTAAAAGGGGAAGACCTATTTCCACATGAGGTT TTGTAGCATGAACTATAAGCCTCAGAATTGCATCTTCAAGTGCCAAAAGTTTAAATACTTTCTTACACAT TTTTATACTTCTGCTATACACTAAATATAACCTAAAAGCAATTGTATAGCAGTCTTCAGTGCTTACAGTA TAACTCTATTAATGATTTTGTTTCCTAAAGTCAGATGATGTCTATTTAGTTCATCCTTATTACTGCTTTG TCTTTATAATTTTAGTTTTTACAGTGTTATTTATTGTTTATATAATGGTTGTTTTACAAATTGTTGTCCT CTGTTTAAT
Notes:	The probe template was PCR amplified from IMAGE:1328607 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1328607 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_001970 same experiment
	EMAGE:30291 same embryo
	EMAGE:30586 same embryo
	EMAGE:30556 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source