Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30678

Cpsf4 cleavage and polyadenylation specific factor 4 ( MGI:1861602)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30678 EMAGE:30678 EMAGE:30678 EMAGE:30678 EMAGE:30678
euxassay_002760_01 euxassay_002760_02 euxassay_002760_03 euxassay_002760_04 euxassay_002760_05
EMAGE:30678 EMAGE:30678 EMAGE:30678 EMAGE:30678 EMAGE:30678
euxassay_002760_06 euxassay_002760_07 euxassay_002760_08 euxassay_002760_09 euxassay_002760_10
EMAGE:30678 EMAGE:30678 EMAGE:30678 EMAGE:30678 EMAGE:30678
euxassay_002760_11 euxassay_002760_12 euxassay_002760_13 euxassay_002760_14 euxassay_002760_15
EMAGE:30678 EMAGE:30678 EMAGE:30678 EMAGE:30678 EMAGE:30678
euxassay_002760_16 euxassay_002760_17 euxassay_002760_18 euxassay_002760_19 euxassay_002760_20
EMAGE:30678 EMAGE:30678 EMAGE:30678 EMAGE:30678
euxassay_002760_21 euxassay_002760_22 euxassay_002760_23 euxassay_002760_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T162
Entity Detected:Cpsf4, cleavage and polyadenylation specific factor 4 ( MGI:1861602)
Sequence:sense strand is shown

>T162
GGCGGCTGCGGCGGCGGCGGCGGCGGCAAGCGAGAAGGGGACGGGGAGAGGTAGCGTGAGTTGCGGAGAG
CGGCTGAGAGACCTGAGGGGGAGCTGGGCCCGAGGCCGCCGCCGCCGCCATGCAGGAAATAATCGCCAGC
GTAGATCACATCAAGTTCGACTTGGAGATCGCCGTGGAGCAGCAGCTCGGGGCGCAGCCGCTGCCCTTCC
CCGGCATGGATAAGTCAGGGGCTGCTGTCTGTGAATTCTTTTTGAAAGCCGCCTGTGGCAAAGGGGGCAT
GTGTCCATTCCGCCACATCAGTGGTGAGAAGACAGTTGTGTGCAAACACTGGCTGAGAGGACTGTGCAAG
AAAGGGGACCAGTGTGAGTTCTTGCATGAATATGACATGACCAAGATGCCTGAGTGCTACTTTTACTCCA
AGTTCGGGGAATGCAGCAATAAGGAGTGCCCCTTCCTGCACATCGACCCTGAATCCAA
Notes:The probe template was PCR amplified from IMAGE:2644929 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2644929 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002760 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS