Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30696

A630075K04Rik (A630075K04Rik)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30696 EMAGE:30696 EMAGE:30696 EMAGE:30696 EMAGE:30696
euxassay_016924_01 euxassay_016924_02 euxassay_016924_03 euxassay_016924_04 euxassay_016924_05
EMAGE:30696 EMAGE:30696 EMAGE:30696 EMAGE:30696 EMAGE:30696
euxassay_016924_06 euxassay_016924_07 euxassay_016924_08 euxassay_016924_09 euxassay_016924_10
EMAGE:30696 EMAGE:30696 EMAGE:30696 EMAGE:30696 EMAGE:30696
euxassay_016924_11 euxassay_016924_12 euxassay_016924_13 euxassay_016924_14 euxassay_016924_15
EMAGE:30696 EMAGE:30696 EMAGE:30696 EMAGE:30696 EMAGE:30696
euxassay_016924_16 euxassay_016924_17 euxassay_016924_18 euxassay_016924_19 euxassay_016924_20
EMAGE:30696 EMAGE:30696 EMAGE:30696 EMAGE:30696
euxassay_016924_21 euxassay_016924_22 euxassay_016924_23 euxassay_016924_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45459
Entity Detected:A630075K04Rik, (A630075K04Rik)
Sequence:sense strand is shown

>T45459
ATCCTTGATACCGGAGCAGATAAAAGTATAATTTCTACACATTGGTGGCCCAAAGCATGGCCCACCACAG
AGTCATCTCATTCATTACAGGGCCTAGGATATCAATCATGTCCCACTATAAGCTCCGTTGCCTTGACGTG
GGAATCCTCTGAAGGGCAGCAAGGGAAATTCATACCTTATGTGCTCCCACTCCCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 264577264577. Forward Primer - name:264577_F_exon_LOC435551, sequence:ATCCTTGATACCGGAGCAGATA; Reverse Primer - name:264577_N_SP6_exon_LOC435551, sequence:CGGGAGTGGGAGCACATAAG.The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016924 same experiment
 EMAGE:30695 same embryo
 EMAGE:30673 same embryo
 EMAGE:30672 same embryo
 EMAGE:30698 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS