Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30724

Wipi2 WD repeat domain, phosphoinositide interacting 2 ( MGI:1923831)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30724 EMAGE:30724 EMAGE:30724 EMAGE:30724 EMAGE:30724
euxassay_003259_01 euxassay_003259_02 euxassay_003259_03 euxassay_003259_04 euxassay_003259_05
EMAGE:30724 EMAGE:30724 EMAGE:30724 EMAGE:30724 EMAGE:30724
euxassay_003259_06 euxassay_003259_07 euxassay_003259_08 euxassay_003259_09 euxassay_003259_10
EMAGE:30724 EMAGE:30724 EMAGE:30724 EMAGE:30724 EMAGE:30724
euxassay_003259_11 euxassay_003259_12 euxassay_003259_13 euxassay_003259_14 euxassay_003259_15
EMAGE:30724 EMAGE:30724 EMAGE:30724 EMAGE:30724 EMAGE:30724
euxassay_003259_16 euxassay_003259_17 euxassay_003259_18 euxassay_003259_19 euxassay_003259_20
EMAGE:30724 EMAGE:30724 EMAGE:30724 EMAGE:30724
euxassay_003259_21 euxassay_003259_22 euxassay_003259_23 euxassay_003259_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T51
Entity Detected:Wipi2, WD repeat domain, phosphoinositide interacting 2 ( MGI:1923831)
Sequence:sense strand is shown

>T51
TTTTTTTTTTTTTTAAAGTCACTGAAGTGAAAACTGTATTTTCTCAACAGTATGGATAGGCTATAACTAC
AACCTCTGCTTTAAGTCTCTGCCATCCTCTCCCTCAATTCAGGTCAAAGTTCATAGCAGCAATGCTCAAG
TCCTCAGCCAGGCAGTGTTGTCTGCTCCTGGGCCAGAGTTCACAGGTCAGGATCAGTCAGTCCGGAGAAT
CATGGGAGGATGTTCGCTGTCTTCATCCAGGCGCAGAGCGCTGGCTTCATCCTCTAGGCATGCACCACCC
ACAGCACCCAGGNCATCTGTGTAN
Notes:The probe template was PCR amplified from IMAGE:1080066 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1080066 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_003259 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS