Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30748

Mcpt9 ( MGI:1194491)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30748 EMAGE:30748 EMAGE:30748 EMAGE:30748 EMAGE:30748
euxassay_016555_01 euxassay_016555_02 euxassay_016555_03 euxassay_016555_04 euxassay_016555_05
EMAGE:30748 EMAGE:30748 EMAGE:30748 EMAGE:30748 EMAGE:30748
euxassay_016555_06 euxassay_016555_07 euxassay_016555_08 euxassay_016555_09 euxassay_016555_10
EMAGE:30748 EMAGE:30748 EMAGE:30748 EMAGE:30748 EMAGE:30748
euxassay_016555_11 euxassay_016555_12 euxassay_016555_13 euxassay_016555_14 euxassay_016555_15
EMAGE:30748 EMAGE:30748 EMAGE:30748 EMAGE:30748 EMAGE:30748
euxassay_016555_16 euxassay_016555_17 euxassay_016555_18 euxassay_016555_19 euxassay_016555_20
EMAGE:30748 EMAGE:30748 EMAGE:30748 EMAGE:30748
euxassay_016555_21 euxassay_016555_22 euxassay_016555_23 euxassay_016555_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39338
Entity Detected:Mcpt9, ( MGI:1194491)
Sequence:sense strand is shown

>T39338
TGATGCCCTCACACTGGTTAACACAAACAAGAACCTCAGGCTAAAGCAGCCCACCACCAGTTTTTGTAAA
TAAAATGTCCTTCCTCTCACCCATATGTTCACAAACCACAGACCCCTGTGTTACAGGAACAGAGATGAGT
CTTTACACGTATGCAGCATGGGTCTATAAGCTGACAATAATACCTGGATGCTTTCAAGAACAGTTCCATG
ATCCCTGATCAAGGTTCCCCTTCCTTTGTGTTGCTCTCCTTCCTCCTGGGAACTACTTTGAAGGGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 277459. Forward Primer - name:277459_F_cDNA_Mcpt9, sequence:TGATGCCCTCACACTGGTTA; Reverse Primer - name:277459_N_SP6_cDNA_Mcpt9, sequence:ACCCTTCAAAGTAGTTCCCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016555 same experiment
 EMAGE:30745 same embryo
 EMAGE:30749 same embryo
 EMAGE:30750 same embryo
 EMAGE:30766 same embryo
 EMAGE:30752 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS