Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30798

Pamr1 peptidase domain containing associated with muscle regeneration 1 ( MGI:2445082)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30798 EMAGE:30798 EMAGE:30798 EMAGE:30798 EMAGE:30798
euxassay_002904_01 euxassay_002904_02 euxassay_002904_03 euxassay_002904_04 euxassay_002904_05
EMAGE:30798 EMAGE:30798 EMAGE:30798 EMAGE:30798 EMAGE:30798
euxassay_002904_06 euxassay_002904_07 euxassay_002904_08 euxassay_002904_09 euxassay_002904_10
EMAGE:30798 EMAGE:30798 EMAGE:30798 EMAGE:30798 EMAGE:30798
euxassay_002904_11 euxassay_002904_12 euxassay_002904_13 euxassay_002904_14 euxassay_002904_15
EMAGE:30798 EMAGE:30798 EMAGE:30798 EMAGE:30798 EMAGE:30798
euxassay_002904_16 euxassay_002904_17 euxassay_002904_18 euxassay_002904_19 euxassay_002904_20
EMAGE:30798 EMAGE:30798 EMAGE:30798 EMAGE:30798
euxassay_002904_21 euxassay_002904_22 euxassay_002904_23 euxassay_002904_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hip mesenchyme
strong strong
regionalstrong expression: see section 01 02
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 04 05 06 07 23 24
knee mesenchyme
strong strong
regionalstrong expression: see section 01 02
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 04 05 06 07 23 24
clavicle
strong strong
regionalstrong expression: see section 08 09 10 11 17 18 19 20
rectum
moderate moderate
regionalmoderate expression: see section 14 15
axial skeleton tail region
strong strong
regionalstrong expression: see section 14 15 16 17
lower leg mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 23 24
midgut loop
strong strong
regionalstrong expression: see section 06 moderate expression: see section 07 09 10 11 12 13 14 15 18 19 20
upper arm mesenchyme
strong strong
regionalstrong expression: see section 01 02 03
pancreas
strong strong
regionalstrong expression: see section 09 10 11 12 15 16 17 18
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 03 04 05 06 22 23 24
upper leg mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 09 10 19 20 22 23 24
midbrain ventricular layer
strong strong
regionalstrong expression: see section 13 moderate expression: see section 12 14 15
hindgut
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19
upper lip
strong strong
regionalstrong expression: see section 14 15 16 17 moderate expression: see section 13
lower lip
strong strong
regionalstrong expression: see section 14 15 16 moderate expression: see section 13
thoracic intervertebral disc
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 03 04 05 23 24
head mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 22 23 24
lumbar intervertebral disc
strong strong
regionalstrong expression: see section 13 14 15 16 19
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 13
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 moderate expression: see section 07 08 09 10
kidney calyx
moderate moderate
regionalmoderate expression: see section 08 09 10 18 19 20 21
tongue
strong strong
regionalstrong expression: see section 17
cranium
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 04 05 23
shoulder mesenchyme
strong strong
regionalstrong expression: see section 01 02
pons ventricular layer
strong strong
regionalstrong expression: see section 13
foot mesenchyme
strong strong
regionalstrong expression: see section 03 04 05 06 22 23 24
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 03 04 05 06 22 23 24
body-wall mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 24
tongue muscle
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17
midgut
moderate moderate
regionalmoderate expression: see section 08 12 16 17
urinary system
strong strong
single cellstrong expression: see section 05 06 23 24
elbow mesenchyme
strong strong
regionalstrong expression: see section 01 02
hand mesenchyme
strong strong
regionalstrong expression: see section 05 06 23 24
cervical intervertebral disc
strong strong
regionalstrong expression: see section 08 10 12 13 14 15 16 17 18 19
forearm mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04
sacral vertebral cartilage condensation
strong strong
regionalstrong expression: see section 14 15 16 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T202
Entity Detected:Pamr1, peptidase domain containing associated with muscle regeneration 1 ( MGI:2445082)
Sequence:sense strand is shown

>T202
CTGAGCCTAGAGTTTGACTACATGTGCCAATATGACTACGTGGAGGTCCGCGATGGGGATAATAGTGACA
GCCCTATCATCAAGCGTTTCTGTGGCAACGAGAGGCCAGCTCCCATCAGGAGCACTGGCTCTTCACTCCA
TGTCCTTTTCCATTCTGATGGCTCCAAGAACTTCGATGGCTTCCACGCTGTCTTTGAGGAGATCACAGCG
TGCTCCTCATCCCCTTGTTTCCATGATGGCACATGCCTCCTTGACACCACTGGGTCTTTCAAGTGTGCCT
GCCTGGCTGGCTACACTGGGCAGCGCTGTGAAAATCTACTTGAAGAAAGAAACTGCTCAGACCTTGGGGG
GCCAGTCAATGGGTACAAGAAAATCACAGAAGGTCCTGGACTTCTCAATGAGCGCCATGTAAAAATTGGC
ACGGTTGTGTCTTTCTTTTGTAACGGCTCATACGTTCTGAGTGGCAATGAGAAACGAACTTG
Notes:The probe template was PCR amplified from IMAGE:2648551 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2648551 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002904 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS