Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30800

Dact2 dapper homolog 2, antagonist of beta-catenin (xenopus) ( MGI:1920347)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30800 EMAGE:30800 EMAGE:30800 EMAGE:30800 EMAGE:30800
euxassay_002903_01 euxassay_002903_02 euxassay_002903_03 euxassay_002903_04 euxassay_002903_05
EMAGE:30800 EMAGE:30800 EMAGE:30800 EMAGE:30800 EMAGE:30800
euxassay_002903_06 euxassay_002903_07 euxassay_002903_08 euxassay_002903_09 euxassay_002903_10
EMAGE:30800 EMAGE:30800 EMAGE:30800 EMAGE:30800 EMAGE:30800
euxassay_002903_11 euxassay_002903_12 euxassay_002903_13 euxassay_002903_14 euxassay_002903_15
EMAGE:30800 EMAGE:30800 EMAGE:30800 EMAGE:30800 EMAGE:30800
euxassay_002903_16 euxassay_002903_17 euxassay_002903_18 euxassay_002903_19 euxassay_002903_20
EMAGE:30800 EMAGE:30800 EMAGE:30800 EMAGE:30800
euxassay_002903_21 euxassay_002903_22 euxassay_002903_23 euxassay_002903_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
stomach
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 moderate expression: see section 01 02 03 10 11
kidney calyx
strong strong
regionalstrong expression: see section 08 09 11 12 17 18 20 21 22
rectum
moderate moderate
regionalmoderate expression: see section 14 15
urethra of male
moderate moderate
regionalmoderate expression: see section 13 14 15
midgut
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 moderate expression: see section 03 10 11 12 13 14 15 16 17 18 19 20
bladder
moderate moderate
regionalmoderate expression: see section 13 14
esophagus
moderate moderate
regionalmoderate expression: see section 13 14
pancreas
moderate moderate
regionalmoderate expression: see section 09 10 11 12
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 19 21 weak expression: see section 20
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 11 17 18 19 20 21
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 09 19 21 weak expression: see section 20
thymus primordium
strong strong
homogeneousstrong expression: see section 12 13 14 15 16 17
kidney pelvis
strong strong
regionalstrong expression: see section 10 19
vibrissa
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 05 06 07 22 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 16 17 18 19 20
hindgut
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T341
Entity Detected:Dact2, dapper homolog 2, antagonist of beta-catenin (xenopus) ( MGI:1920347)
Sequence:sense strand is shown

>T341
GCGGGGAGCCCTGGGCCTGCACCCTGCGCCAGGGCCCCGCGGCCAGGAGCTGCGTCTGGAGGCGGCGCTG
ACCGCGCTACGGGAGCAGCTGTCACGGCTAAGGAGACAGGATGCTGGCCTGAAGACACACTTGGACCAGC
TGGATCAGCAGATAAGTGAACTACAGCTGGATGTGAGCAGGTCTTCTTGCGAGGCCTTGGATAGTGACAG
CAGACCCAGCTCAGGTTTCTATGAGCTGAGCGATGCTGGTTCCTGTTCTCTGTCCACCTCCTGCGCATCT
GTTTGCAGCGACCGTCTATCCCCCTCCCTGGGTAGCTGGCTGCCTGTGTTCCAGCCCTCCAAGTCCAGGT
CTGGCATCGGGGACT
Notes:The probe template was PCR amplified from IMAGE:3154693 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3154693 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002903 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS