EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30801

Gjb1 ( MGI:95719)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_000729_01	euxassay_000729_02	euxassay_000729_03	euxassay_000729_04	euxassay_000729_05

euxassay_000729_06	euxassay_000729_07	euxassay_000729_08	euxassay_000729_09	euxassay_000729_10

euxassay_000729_11	euxassay_000729_12	euxassay_000729_13	euxassay_000729_14	euxassay_000729_15

euxassay_000729_16	euxassay_000729_17	euxassay_000729_18	euxassay_000729_19	euxassay_000729_20

euxassay_000729_21	euxassay_000729_22	euxassay_000729_23	euxassay_000729_24

View assay images:
Expression pattern clarity:

Expression Pattern Description

Text Annotation:

Structure

Level

Pattern

Notes

liver lobe

weak

homogeneous

weak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

Annotation Validation:

text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T882
Entity Detected:	Gjb1, ( MGI:95719)
Sequence:	sense strand is shown >T882 TCCTCGAGNCTGTTGGCCTACTGGATACTTCCCTGNGAAAAGGAGTTGCAACCAGGTGTGGCAGTGCCAG GGAGGTGTGAATGAGGCAGGATGAACTGGACAGGTCTATACACCTTGCTCAGTGGCGTGAATCGGCACTC TACAGCCATTGGCCGAGTATGGCTGTCTGTCATCTTCATCTTCAGAATCATGGTGCTGGTGGTGGCTGCT GAGAGCGTGTGGGGGGATGAGAAGTCCTCTTTCATCTGTAACACCCTCCAGCCGGGCTGCAACAGCGTCT GCTATGACCATTTTTTTCCCCATCTCCCACGTGCGCCTATGGTCCCTGCAGCTTATCTTGGTTTCCACCC CAGCTCTCCTCGTGGCAATGCACGTAGCTCACCAACAGCACATAGAAAAGAAAATGCTACGGCTTGAGGG GCATGGGGACCCCCTTCACCTGGAAGAGGTAAAGAGACACAAGGTGCACATCTCAGGGACACTGTGGTGG ACCTATGTCATCAGTGTGGTGTTCCGGCTGCTGTTCGAGGCTGTCTTCATGTATGTCTT
Notes:	The probe template was PCR amplified from IMAGE:1923932 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1923932 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_000729 same experiment
	EMAGE:30208 same embryo
	EMAGE:29184 same embryo
	EMAGE:31768 same embryo
	EMAGE:31772 same embryo
	EMAGE:30601 same embryo
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source