Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30813

Fam49a ( MGI:1261783)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30813 EMAGE:30813 EMAGE:30813 EMAGE:30813 EMAGE:30813
euxassay_007357_01 euxassay_007357_02 euxassay_007357_03 euxassay_007357_04 euxassay_007357_05
EMAGE:30813 EMAGE:30813 EMAGE:30813 EMAGE:30813 EMAGE:30813
euxassay_007357_06 euxassay_007357_07 euxassay_007357_08 euxassay_007357_09 euxassay_007357_10
EMAGE:30813 EMAGE:30813 EMAGE:30813 EMAGE:30813 EMAGE:30813
euxassay_007357_11 euxassay_007357_12 euxassay_007357_13 euxassay_007357_14 euxassay_007357_15
EMAGE:30813 EMAGE:30813 EMAGE:30813 EMAGE:30813 EMAGE:30813
euxassay_007357_16 euxassay_007357_17 euxassay_007357_18 euxassay_007357_19 euxassay_007357_20
EMAGE:30813 EMAGE:30813 EMAGE:30813
euxassay_007357_21 euxassay_007357_22 euxassay_007357_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
olfactory cortex mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 14 15 16
thalamus mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 14 15 16 weak expression: see section 07 08 11 13 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3263
Entity Detected:Fam49a, ( MGI:1261783)
Sequence:sense strand is shown

>T3263
TGGCCTCGAGCCAGATTCGGCACGAGGGCAATTCAAATCCCAATGACATTCAACTTCAGGAGAAGGCTTG
GAATGCAGTGTGTCCTCTGGTGGTGAGGCTGAAGAGGTTTTACGAATTCTCCATCCGTCTTGAAAAAGCA
CTTCAGAGTTTATTGGAATCTCTGACGTGTCCACCCTATACACCAACCCAGCACCTGGAACGGGAGCAAG
CCCTCGCAAAGGAATTTGCAGAAATCTTACATTTTACCCTTCGATTCGATGAGCTGAAGATGAGGAACCC
CGCTATTCAGAATGACTTCAGTTACTATCGAAGAACAATAAGTCGTAACCGTATCAACAACATGCATCTA
GACATTGAGAATGAAGTTAATAATGAGATGGCCAATCGAATGTCCCTCTTCTATGCAGAAGCCACACCGA
TGTTGAAGACTCTTAGCAATGCCACAATGCACTTTGTCTCCGAAAATAAAACCCTGCCAATAGAGAATAC
CACGGACTGCCTCAGTACGATGACAAGCGTCTGTAAAGTCATGCTGGAGACACCGGAGTACAGGAGCAGG
TT
Notes:The probe template was PCR amplified from IMAGE:2779968 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2779968 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007357 same experiment
 EMAGE:30803 same embryo
 EMAGE:30834 same embryo
 EMAGE:30815 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS