Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30815

Accn3 ( MGI:2159339)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30815 EMAGE:30815 EMAGE:30815 EMAGE:30815 EMAGE:30815
euxassay_007353_01 euxassay_007353_02 euxassay_007353_03 euxassay_007353_04 euxassay_007353_05
EMAGE:30815 EMAGE:30815 EMAGE:30815 EMAGE:30815 EMAGE:30815
euxassay_007353_06 euxassay_007353_07 euxassay_007353_08 euxassay_007353_09 euxassay_007353_10
EMAGE:30815 EMAGE:30815 EMAGE:30815 EMAGE:30815 EMAGE:30815
euxassay_007353_11 euxassay_007353_12 euxassay_007353_13 euxassay_007353_14 euxassay_007353_15
EMAGE:30815 EMAGE:30815 EMAGE:30815 EMAGE:30815 EMAGE:30815
euxassay_007353_16 euxassay_007353_17 euxassay_007353_18 euxassay_007353_19 euxassay_007353_20
EMAGE:30815 EMAGE:30815
euxassay_007353_21 euxassay_007353_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
weak weak
spottedweak expression: see section 09 10 11 12 13 17 18
facial vii ganglion
weak weak
spottedweak expression: see section 04 05
vagus x ganglion
weak weak
spottedweak expression: see section 07 17 18
trigeminal v ganglion
weak weak
spottedweak expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
pectoral girdle and thoracic body wall muscle
weak weak
regionalweak expression: see section 03 04 05 06 07 08 20
vestibulocochlear viii ganglion
weak weak
spottedweak expression: see section 05 06 07 08 17 18 19 20 21
glossopharyngeal ix ganglion
weak weak
spottedweak expression: see section 05 06 07 18 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3262
Entity Detected:Accn3, ( MGI:2159339)
Sequence:sense strand is shown

>T3262
TGGCCTCGAGCCAGATTCGGAAGAGGGGGAATGGAGTGTCTGGGGCCTTAAAGGCCCCTCCCTGCAGAAG
AGACCCCATTTGAGGTGGGGATCCGAGTGCAGATCCACGGCCAGGAGGAACCCCCTGCCATTGACCAGCT
GGGCTTCGGTGCTGCCCCAGGCCACCAGACTTTTGTGTCCTGCCAGCAACAGCAACTGAGTTTCCTGCCA
CCACCCTGGGGTGACTGCAATACCGCATCTGTGGATCCCGACTTTGATCCAGAGCCCTCTGATCCCCTGG
GTTCCCCTAGCTCCAGCCCTCCTTATAGCTTAATAGGGTGTCGCCTGGCCTGTGAGTCACGCTATGTGGC
TCGGAAGTGCGGATGTCGAATGATGCATATGCCTGGAAACTCCCCAGTGTGCAGCCCCCAGCAGTACAAG
GACTGTGCCAGCCCAGCTCTGGACGCTATGCTGCGAAAGGACACTTGTGTCTGTCCCAACCCGTGCGCCA
CTACACGCTATGCCAAGGAGCTCTCCATGGTGCGGATTCCCAGCCGCGCTTCAGCTCGCTACCTGG
Notes:The probe template was PCR amplified from IMAGE:2779963 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2779963 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007353 same experiment
 EMAGE:30803 same embryo
 EMAGE:30813 same embryo
 EMAGE:30834 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS