Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30821

Siae sialic acid acetylesterase ( MGI:104803)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30821 EMAGE:30821 EMAGE:30821 EMAGE:30821 EMAGE:30821
euxassay_002911_01 euxassay_002911_02 euxassay_002911_03 euxassay_002911_04 euxassay_002911_05
EMAGE:30821 EMAGE:30821 EMAGE:30821 EMAGE:30821 EMAGE:30821
euxassay_002911_06 euxassay_002911_07 euxassay_002911_08 euxassay_002911_09 euxassay_002911_10
EMAGE:30821 EMAGE:30821 EMAGE:30821 EMAGE:30821 EMAGE:30821
euxassay_002911_11 euxassay_002911_12 euxassay_002911_13 euxassay_002911_14 euxassay_002911_15
EMAGE:30821 EMAGE:30821 EMAGE:30821 EMAGE:30821 EMAGE:30821
euxassay_002911_16 euxassay_002911_17 euxassay_002911_18 euxassay_002911_19 euxassay_002911_20
EMAGE:30821 EMAGE:30821 EMAGE:30821 EMAGE:30821
euxassay_002911_21 euxassay_002911_22 euxassay_002911_23 euxassay_002911_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate
moderate moderate
regionalmoderate expression: see section 10 18 weak expression: see section 11 17
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 14
ventral grey horn
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 17
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 14
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T331
Entity Detected:Siae, sialic acid acetylesterase ( MGI:104803)
Sequence:sense strand is shown

>T331
GGATCTTCACAAACATGGTTTCCCCGGGGCCTGTGTTTGGGATAGTGCTGCTCATAATCGCGCGAGTCAG
CAGAAGTGCAGGTATTGGTTTTCGCTTTGCTTCATACATCGATAATTACATGGTGCTGCAGAAGGAGCCT
TCAGGGGCTGTGATCTGGGGCTTTGGTACACCTGGAGCCACAGTGACAGTGACCTTGTGCCAAGGTCAGG
AAACCATCATGAAGAAAGTGACCAGTGTGAAAGAACCCTCCAACACCTGGATGGTGGTACTGGACCCTAT
GAAGCCTGGGGGACCTTTTGAAGTGATGGCGCAACAGACTTTGGGGACAATGAATTTCACCCTGAGAGTC
CATGATGTCTTATTTGGAGATGTCTGGCTTTGCAGTGGGCAGAGTAACATGCAGATGACTGTTTCACAGA
TCTTTAACGCCTCAAAGGAGTTGTCCGACACTGCTGCCTACCAGTCTGTGCGCATCTT
Notes:The probe template was PCR amplified from IMAGE:3154483 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3154483 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002911 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS