Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30836

4732414G09Rik ( MGI:3045381)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30836 EMAGE:30836 EMAGE:30836 EMAGE:30836 EMAGE:30836
euxassay_016054_01 euxassay_016054_02 euxassay_016054_03 euxassay_016054_04 euxassay_016054_05
EMAGE:30836 EMAGE:30836 EMAGE:30836 EMAGE:30836 EMAGE:30836
euxassay_016054_06 euxassay_016054_07 euxassay_016054_08 euxassay_016054_09 euxassay_016054_10
EMAGE:30836 EMAGE:30836 EMAGE:30836 EMAGE:30836 EMAGE:30836
euxassay_016054_11 euxassay_016054_12 euxassay_016054_13 euxassay_016054_14 euxassay_016054_15
EMAGE:30836 EMAGE:30836 EMAGE:30836 EMAGE:30836
euxassay_016054_16 euxassay_016054_17 euxassay_016054_18 euxassay_016054_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 12 13 moderate expression: see section 14
facial vii ganglion
strong strong
regionalstrong expression: see section 03 moderate expression: see section 04 05 16
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 moderate expression: see section 04 05 06 14 15 16 17 18 19
ventral grey horn
strong strong
regionalstrong expression: see section 07 moderate expression: see section 08 09 10 11 12 13
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 15
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39910
Entity Detected:4732414G09Rik, ( MGI:3045381)
Sequence:sense strand is shown

>T39910
GACCTCGTGATTCTGAATAGGGGCTGGAACTCCAGTTATCACGTATGCATTCCAGGTTTTGGAATGGAGA
AAAATAATGAAGGGTCGATGCTAACTCTTTATTTTATGTGGGTGACTGTTTTGCCTACATGTATGCCTAT
ATGTGCATCTGTGTGTGCTTACGGAGAGTTGTGAGCCACTGTGTGGGTGCTGGGAACTGAATCTGGCTCC
CCTGTAAGAACAGCATGTGCTCTCAACCACTGAGCCATCTCTCTACCCCAACAGTAGCTCTTTTAAAGAC
AGCGCCACGGAACATTCCCTGTGCATCCCACTAACGTGAATTTTGTCACATAACCAGACCAGGTAGCAAG
AGCAAGAACATGAAAAGGGGCCGGGCAGTGGTGGTGGATCCCTTTAATCCCAACACTCAGAGGCAGACGC
AGGTAGATCTCCAAGTTCAAGGCCAGCCTGGACTATAGAGCGAGTTCCAGAACAGCCAAGGCTACACAGA
GAAACGTATCTCGAAACAAAGCAAAGCAAAACAAAACAAAAAAAGGAAAGAAAGGGGAAAAAACCTACCA
CCACCACCAACAACAAATGCAACCTCCATCATAGGCAGCCAAAAGCCCAACCAAGGAGCAAGGATTATAG
CACCAAGAAACCAAGAAGACCCTGTGTGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 87526. Forward Primer - name:087526_F_cDNA_LOC432578, sequence:GACCTCGTGATTCTGAATAGGG; Reverse Primer - name:087526_N_SP6_cDNA_LOC432578, sequence:CACACACAGGGTCTTCTTGGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016054 same experiment
 EMAGE:29968 same embryo
 EMAGE:29945 same embryo
 EMAGE:30155 same embryo
 EMAGE:29952 same embryo
 EMAGE:30500 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS